\
| Variant ID: vg0406786851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6786851 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCATCAGAGAGAGGTTGAGAATTGCACAATCTCGACAGAAGAGCTACGCAGACAACCACCGAAGGGAGCTCACTTTTGAAGCAGGGGATTATGTGTACCT[T/C]
CGTGTCACTCCGCTCCGGGGAGTGCACTGTTTCCAGACGAAAGGCAAGTTGGCACCATGTTTCGTGGGACCATACAAGATCTTGGAACGAAGAGGAGAAG
CTTCTCCTCTTCGTTCCAAGATCTTGTATGGTCCCACGAAACATGGTGCCAACTTGCCTTTCGTCTGGAAACAGTGCACTCCCCGGAGCGGAGTGACACG[A/G]
AGGTACACATAATCCCCTGCTTCAAAAGTGAGCTCCCTTCGGTGGTTGTCTGCGTAGCTCTTCTGTCGAGATTGTGCAATTCTCAACCTCTCTCTGATGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 2.30% | 7.55% | 0.95% | NA |
| All Indica | 2759 | 85.20% | 4.00% | 10.87% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.40% | 0.46% | NA |
| Aus | 269 | 84.00% | 0.00% | 11.90% | 4.09% | NA |
| Indica I | 595 | 91.10% | 2.90% | 6.05% | 0.00% | NA |
| Indica II | 465 | 90.10% | 3.90% | 6.02% | 0.00% | NA |
| Indica III | 913 | 77.80% | 5.70% | 16.54% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 2.80% | 10.81% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.79% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 58.30% | 0.00% | 15.62% | 26.04% | NA |
| Intermediate | 90 | 92.20% | 1.10% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406786851 | T -> C | LOC_Os04g12290.1 | synonymous_variant ; p.Leu250Leu; LOW | synonymous_codon | Average:37.07; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0406786851 | T -> DEL | LOC_Os04g12290.1 | N | frameshift_variant | Average:37.07; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406786851 | 5.48E-06 | NA | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | 4.47E-06 | 4.47E-06 | mr1054 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 5.23E-06 | mr1187 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 9.25E-06 | mr1279 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 8.17E-06 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | 1.90E-06 | 3.59E-06 | mr1331 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | 7.64E-07 | 7.64E-07 | mr1331 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 2.64E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 1.87E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 3.14E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 5.64E-06 | mr1573 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 2.24E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 6.13E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 9.78E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 2.53E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 2.18E-06 | mr1895 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406786851 | NA | 6.83E-12 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |