Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406785791:

Variant ID: vg0406785791 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6785791
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAGCAGGAAAAGCTACTGCAACGCTTCTTGCACTGGCGGCATGTGTAAAGAAATGCAGCAGGAGCTTGAACATCTCAACTTGGGGATTATAGAACACG[A/G]
GTACGTGGCTGCCCCAGAGGCACGGTCTACGCTCGTGGATCAAGTCCGAGCAGCTCAGGTAAATGATCCTGAAATAGCAGAGCTGAAAAAGAATATGAGG

Reverse complement sequence

CCTCATATTCTTTTTCAGCTCTGCTATTTCAGGATCATTTACCTGAGCTGCTCGGACTTGATCCACGAGCGTAGACCGTGCCTCTGGGGCAGCCACGTAC[T/C]
CGTGTTCTATAATCCCCAAGTTGAGATGTTCAAGCTCCTGCTGCATTTCTTTACACATGCCGCCAGTGCAAGAAGCGTTGCAGTAGCTTTTCCTGCTTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	12.00%	0.87%	38.70%	NA
All Indica	2759	24.90%	18.50%	1.38%	55.27%	NA
All Japonica	1512	95.50%	2.70%	0.07%	1.72%	NA
Aus	269	24.50%	2.20%	0.37%	72.86%	NA
Indica I	595	55.10%	5.90%	1.34%	37.65%	NA
Indica II	465	29.00%	14.80%	1.29%	54.84%	NA
Indica III	913	3.80%	26.30%	1.53%	68.35%	NA
Indica Intermediate	786	23.90%	21.10%	1.27%	53.69%	NA
Temperate Japonica	767	96.70%	3.00%	0.00%	0.26%	NA
Tropical Japonica	504	96.00%	1.20%	0.20%	2.58%	NA
Japonica Intermediate	241	90.50%	5.00%	0.00%	4.56%	NA
VI/Aromatic	96	39.60%	1.00%	1.04%	58.33%	NA
Intermediate	90	63.30%	7.80%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406785791	A -> DEL	LOC_Os04g12290.1	N	frameshift_variant	Average:35.163; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg0406785791	A -> G	LOC_Os04g12290.1	missense_variant ; p.Glu16Gly; MODERATE	nonsynonymous_codon ; E16G	Average:35.163; most accessible tissue: Minghui63 flag leaf, score: 64.867	probably damaging	-2.126	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406785791	NA	9.37E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	5.65E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	8.67E-09	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	5.95E-09	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	7.00E-07	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	1.09E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	1.80E-10	mr1100_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	6.38E-07	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	4.35E-07	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	4.86E-09	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	4.04E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	1.43E-07	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	1.90E-09	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406785791	NA	3.89E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251