Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406783001:

Variant ID: vg0406783001 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6783001
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, G: 0.22, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAACCTCCAGGCAGAGCCGAGCCAGCCGTCCCGTGCACAGTTGCCGTCGATTTCCCCTCTAAATCCGGTCTCCTTTCTCGTGTTATTTCAAAATTAGT[G/T]
GAGGGGAAATATTCCTCTTATCCTCCTCTATCTCTTTCCCCAAAAATCCGGTTTTATCCCTTTGAATTCGACGCAAATTTGGATTCATTTTCGAGTTTAT

Reverse complement sequence

ATAAACTCGAAAATGAATCCAAATTTGCGTCGAATTCAAAGGGATAAAACCGGATTTTTGGGGAAAGAGATAGAGGAGGATAAGAGGAATATTTCCCCTC[C/A]
ACTAATTTTGAAATAACACGAGAAAGGAGACCGGATTTAGAGGGGAAATCGACGGCAACTGTGCACGGGACGGCTGGCTCGGCTCTGCCTGGAGGTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	12.00%	0.17%	39.21%	NA
All Indica	2759	25.20%	18.50%	0.25%	56.11%	NA
All Japonica	1512	95.50%	2.70%	0.00%	1.79%	NA
Aus	269	24.50%	2.20%	0.37%	72.86%	NA
Indica I	595	55.10%	5.90%	0.17%	38.82%	NA
Indica II	465	29.20%	14.80%	0.00%	55.91%	NA
Indica III	913	4.20%	26.30%	0.11%	69.44%	NA
Indica Intermediate	786	24.40%	21.10%	0.64%	53.82%	NA
Temperate Japonica	767	96.70%	3.00%	0.00%	0.26%	NA
Tropical Japonica	504	96.00%	1.20%	0.00%	2.78%	NA
Japonica Intermediate	241	90.50%	5.00%	0.00%	4.56%	NA
VI/Aromatic	96	40.60%	1.00%	0.00%	58.33%	NA
Intermediate	90	62.20%	8.90%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406783001	G -> DEL	N	N	silent_mutation	Average:87.824; most accessible tissue: Minghui63 young leaf, score: 98.762	N	N	N	N
vg0406783001	G -> T	LOC_Os04g12290.1	upstream_gene_variant ; 2744.0bp to feature; MODIFIER	silent_mutation	Average:87.824; most accessible tissue: Minghui63 young leaf, score: 98.762	N	N	N	N
vg0406783001	G -> T	LOC_Os04g12280.1	downstream_gene_variant ; 1021.0bp to feature; MODIFIER	silent_mutation	Average:87.824; most accessible tissue: Minghui63 young leaf, score: 98.762	N	N	N	N
vg0406783001	G -> T	LOC_Os04g12280-LOC_Os04g12290	intergenic_region ; MODIFIER	silent_mutation	Average:87.824; most accessible tissue: Minghui63 young leaf, score: 98.762	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0406783001	G	T	0.02	0.01	0.01	0.02	0.02	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406783001	NA	1.17E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	5.17E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	9.95E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	2.43E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	4.18E-06	1.29E-07	mr1392	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	3.08E-07	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	3.24E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	8.77E-06	8.77E-06	mr1573	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	NA	2.62E-06	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	8.22E-06	1.53E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406783001	4.13E-07	4.13E-07	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251