\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406779682:

Variant ID: vg0406779682 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 6779682
Reference Allele: ACAlternative Allele: GC,A
Primary Allele: GCSecondary Allele: AC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCAGCATCGCCCTTTCAACCCAAGCAGCTTCCACAGGGCGCTAGTGTCAGCCAGAACCATTAGGGAGGTCAGCCCAACCGCAGTGCAGCTCCGCGCCC[AC/GC,A]
CAATGGCACCAGCACAGCCAGCTCCATCAGCCCAAGCCAAGAAGGAGACTGGAGCAAAACCAGGGTCCTCCTACAACTGTGGCGAGCTCGGCCACTTTGC

Reverse complement sequence

GCAAAGTGGCCGAGCTCGCCACAGTTGTAGGAGGACCCTGGTTTTGCTCCAGTCTCCTTCTTGGCTTGGGCTGATGGAGCTGGCTGTGCTGGTGCCATTG[GT/GC,T]
GGGCGCGGAGCTGCACTGCGGTTGGGCTGACCTCCCTAATGGTTCTGGCTGACACTAGCGCCCTGTGGAAGCTGCTTGGGTTGAAAGGGCGATGCTGGCG

Allele Frequencies:

Populations Population SizeFrequency of GC(primary allele) Frequency of AC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 34.10% 8.97% 6.81% A: 10.81%
All Indica  2759 56.40% 15.70% 10.26% 1.16% A: 16.56%
All Japonica  1512 1.90% 71.20% 6.28% 17.99% A: 2.65%
Aus  269 71.40% 16.70% 9.67% 0.37% A: 1.86%
Indica I  595 39.20% 26.90% 26.05% 2.02% A: 5.88%
Indica II  465 55.30% 20.60% 9.25% 0.65% A: 14.19%
Indica III  913 68.90% 7.20% 1.75% 0.77% A: 21.36%
Indica Intermediate  786 55.50% 14.00% 8.78% 1.27% A: 20.48%
Temperate Japonica  767 0.30% 71.70% 9.13% 16.04% A: 2.87%
Tropical Japonica  504 3.20% 71.20% 2.18% 22.22% A: 1.19%
Japonica Intermediate  241 4.60% 69.30% 5.81% 15.35% A: 4.98%
VI/Aromatic  96 54.20% 26.00% 12.50% 6.25% A: 1.04%
Intermediate  90 32.20% 37.80% 8.89% 12.22% A: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406779682 AC -> DEL N N silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> GC LOC_Os04g12280.1 upstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> GC LOC_Os04g12260.1 downstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> GC LOC_Os04g12270.1 downstream_gene_variant ; 3207.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> GC LOC_Os04g12270-LOC_Os04g12280 intergenic_region ; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> A LOC_Os04g12280.1 upstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> A LOC_Os04g12260.1 downstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> A LOC_Os04g12270.1 downstream_gene_variant ; 3208.0bp to feature; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg0406779682 AC -> A LOC_Os04g12270-LOC_Os04g12280 intergenic_region ; MODIFIER silent_mutation Average:46.904; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406779682 2.77E-07 NA mr1928 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251