Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406753488:

Variant ID: vg0406753488 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6753488
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGCTCAGTACACTGGATTTGAAGGAAATCAAATGGGTGAGGTGGACAAGGATGCTGGCGATAACGACGCTGCGGATAATCTTGGTCAGATGTTGCAGGA[C/T]
GCAAAGGAGGACTATGAAAGTGAAAAGGAGGCCCATAAATTGGAGCAGATGTTAGAGGACCACGGAACGTCGTTGTACCCAGGTTGCGAGCAGGGGCACA

Reverse complement sequence

TGTGCCCCTGCTCGCAACCTGGGTACAACGACGTTCCGTGGTCCTCTAACATCTGCTCCAATTTATGGGCCTCCTTTTCACTTTCATAGTCCTCCTTTGC[G/A]
TCCTGCAACATCTGACCAAGATTATCCGCAGCGTCGTTATCGCCAGCATCCTTGTCCACCTCACCCATTTGATTTCCTTCAAATCCAGTGTACTGAGCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	4.50%	11.89%	30.89%	NA
All Indica	2759	36.50%	0.80%	17.11%	45.56%	NA
All Japonica	1512	82.70%	12.20%	1.72%	3.37%	NA
Aus	269	45.40%	0.40%	17.10%	37.17%	NA
Indica I	595	48.60%	0.30%	26.05%	25.04%	NA
Indica II	465	33.80%	0.90%	20.22%	45.16%	NA
Indica III	913	31.10%	1.10%	8.87%	58.93%	NA
Indica Intermediate	786	35.20%	0.90%	18.07%	45.80%	NA
Temperate Japonica	767	94.40%	1.40%	1.43%	2.74%	NA
Tropical Japonica	504	69.20%	26.60%	1.59%	2.58%	NA
Japonica Intermediate	241	73.40%	16.60%	2.90%	7.05%	NA
VI/Aromatic	96	57.30%	0.00%	10.42%	32.29%	NA
Intermediate	90	64.40%	3.30%	8.89%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406753488	C -> DEL	LOC_Os04g12240.1	N	frameshift_variant	Average:8.174; most accessible tissue: Callus, score: 33.653	N	N	N	N
vg0406753488	C -> T	LOC_Os04g12240.1	synonymous_variant ; p.Asp539Asp; LOW	synonymous_codon	Average:8.174; most accessible tissue: Callus, score: 33.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406753488	6.25E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	8.15E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	8.82E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	9.99E-08	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	8.08E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	4.78E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	4.80E-06	NA	mr1264	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.95E-11	1.43E-28	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	2.89E-08	4.68E-21	mr1301	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.74E-12	2.61E-26	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.16E-07	2.65E-20	mr1410	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	2.78E-07	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	2.05E-09	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	1.81E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	4.73E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	2.43E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	4.98E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	6.19E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.45E-15	2.13E-34	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.14E-09	1.66E-26	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.07E-15	2.24E-30	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.06E-08	3.63E-22	mr1410_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	4.83E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	1.63E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	NA	7.39E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	1.22E-06	2.01E-14	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406753488	3.22E-06	2.25E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251