\
| Variant ID: vg0406745243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6745243 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATTTGCGGATAATGACAGAAAAAGTAGGATGAGCATGCACATATTGTGTCCATGTAGGGACTGTAGGAATGAGTAGATGATCGTTGATAGCGATGAAGT[G/A]
CATGCACATTTGATAATGAATGGATTTATGAAGAAATATACTTGCTGGACCAAGCATGGAGAGCAAGAGGCGCCTGATGTTGCTGCTGAAGAACTGTTGG
CCAACAGTTCTTCAGCAGCAACATCAGGCGCCTCTTGCTCTCCATGCTTGGTCCAGCAAGTATATTTCTTCATAAATCCATTCATTATCAAATGTGCATG[C/T]
ACTTCATCGCTATCAACGATCATCTACTCATTCCTACAGTCCCTACATGGACACAATATGTGCATGCTCATCCTACTTTTTCTGTCATTATCCGCAAATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 4.70% | 12.27% | 45.30% | NA |
| All Indica | 2759 | 17.20% | 0.20% | 16.49% | 66.11% | NA |
| All Japonica | 1512 | 79.50% | 13.60% | 2.58% | 4.37% | NA |
| Aus | 269 | 14.10% | 0.00% | 21.93% | 63.94% | NA |
| Indica I | 595 | 27.40% | 0.00% | 32.27% | 40.34% | NA |
| Indica II | 465 | 15.90% | 0.40% | 15.27% | 68.39% | NA |
| Indica III | 913 | 13.80% | 0.20% | 5.48% | 80.50% | NA |
| Indica Intermediate | 786 | 14.20% | 0.10% | 18.07% | 67.56% | NA |
| Temperate Japonica | 767 | 94.50% | 0.50% | 1.43% | 3.52% | NA |
| Tropical Japonica | 504 | 54.00% | 38.30% | 4.37% | 3.37% | NA |
| Japonica Intermediate | 241 | 85.10% | 3.30% | 2.49% | 9.13% | NA |
| VI/Aromatic | 96 | 24.00% | 5.20% | 16.67% | 54.17% | NA |
| Intermediate | 90 | 50.00% | 7.80% | 12.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406745243 | G -> DEL | N | N | silent_mutation | Average:14.238; most accessible tissue: Callus, score: 66.982 | N | N | N | N |
| vg0406745243 | G -> A | LOC_Os04g12220.1 | upstream_gene_variant ; 688.0bp to feature; MODIFIER | silent_mutation | Average:14.238; most accessible tissue: Callus, score: 66.982 | N | N | N | N |
| vg0406745243 | G -> A | LOC_Os04g12230.1 | upstream_gene_variant ; 16.0bp to feature; MODIFIER | silent_mutation | Average:14.238; most accessible tissue: Callus, score: 66.982 | N | N | N | N |
| vg0406745243 | G -> A | LOC_Os04g12220-LOC_Os04g12230 | intergenic_region ; MODIFIER | silent_mutation | Average:14.238; most accessible tissue: Callus, score: 66.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406745243 | 2.55E-08 | 2.55E-08 | mr1266 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406745243 | NA | 1.77E-06 | mr1352 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406745243 | NA | 3.98E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406745243 | NA | 1.20E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406745243 | NA | 1.99E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |