\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406745243:

Variant ID: vg0406745243 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6745243
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTGCGGATAATGACAGAAAAAGTAGGATGAGCATGCACATATTGTGTCCATGTAGGGACTGTAGGAATGAGTAGATGATCGTTGATAGCGATGAAGT[G/A]
CATGCACATTTGATAATGAATGGATTTATGAAGAAATATACTTGCTGGACCAAGCATGGAGAGCAAGAGGCGCCTGATGTTGCTGCTGAAGAACTGTTGG

Reverse complement sequence

CCAACAGTTCTTCAGCAGCAACATCAGGCGCCTCTTGCTCTCCATGCTTGGTCCAGCAAGTATATTTCTTCATAAATCCATTCATTATCAAATGTGCATG[C/T]
ACTTCATCGCTATCAACGATCATCTACTCATTCCTACAGTCCCTACATGGACACAATATGTGCATGCTCATCCTACTTTTTCTGTCATTATCCGCAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 4.70% 12.27% 45.30% NA
All Indica  2759 17.20% 0.20% 16.49% 66.11% NA
All Japonica  1512 79.50% 13.60% 2.58% 4.37% NA
Aus  269 14.10% 0.00% 21.93% 63.94% NA
Indica I  595 27.40% 0.00% 32.27% 40.34% NA
Indica II  465 15.90% 0.40% 15.27% 68.39% NA
Indica III  913 13.80% 0.20% 5.48% 80.50% NA
Indica Intermediate  786 14.20% 0.10% 18.07% 67.56% NA
Temperate Japonica  767 94.50% 0.50% 1.43% 3.52% NA
Tropical Japonica  504 54.00% 38.30% 4.37% 3.37% NA
Japonica Intermediate  241 85.10% 3.30% 2.49% 9.13% NA
VI/Aromatic  96 24.00% 5.20% 16.67% 54.17% NA
Intermediate  90 50.00% 7.80% 12.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406745243 G -> DEL N N silent_mutation Average:14.238; most accessible tissue: Callus, score: 66.982 N N N N
vg0406745243 G -> A LOC_Os04g12220.1 upstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:14.238; most accessible tissue: Callus, score: 66.982 N N N N
vg0406745243 G -> A LOC_Os04g12230.1 upstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:14.238; most accessible tissue: Callus, score: 66.982 N N N N
vg0406745243 G -> A LOC_Os04g12220-LOC_Os04g12230 intergenic_region ; MODIFIER silent_mutation Average:14.238; most accessible tissue: Callus, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406745243 2.55E-08 2.55E-08 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406745243 NA 1.77E-06 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406745243 NA 3.98E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406745243 NA 1.20E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406745243 NA 1.99E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251