\
| Variant ID: vg0406728056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6728056 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTAATGGTTCTCATTCGAAATTTATTCCAGTGTTATTAGTACTGTACATCCATTACTGTACTAATGGCTCATTTTACCAGCAAAAGTTTTACAATATTG[C/T]
TTTACTTAATCTTGCTGCAACAAAAATAAATTTAGCATGTTGATTTTATAACTTTCTTTCATTTCTTTTGAAATCTGTTATTCAAAAGTATAAAATTTGT
ACAAATTTTATACTTTTGAATAACAGATTTCAAAAGAAATGAAAGAAAGTTATAAAATCAACATGCTAAATTTATTTTTGTTGCAGCAAGATTAAGTAAA[G/A]
CAATATTGTAAAACTTTTGCTGGTAAAATGAGCCATTAGTACAGTAATGGATGTACAGTACTAATAACACTGGAATAAATTTCGAATGAGAACCATTAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.30% | 0.40% | 34.85% | 19.45% | NA |
| All Indica | 2759 | 19.90% | 0.50% | 50.27% | 29.32% | NA |
| All Japonica | 1512 | 96.40% | 0.10% | 1.19% | 2.38% | NA |
| Aus | 269 | 17.80% | 1.50% | 65.06% | 15.61% | NA |
| Indica I | 595 | 15.10% | 0.20% | 30.08% | 54.62% | NA |
| Indica II | 465 | 23.40% | 0.90% | 48.39% | 27.31% | NA |
| Indica III | 913 | 21.60% | 0.80% | 64.84% | 12.81% | NA |
| Indica Intermediate | 786 | 19.30% | 0.40% | 49.75% | 30.53% | NA |
| Temperate Japonica | 767 | 97.00% | 0.00% | 0.13% | 2.87% | NA |
| Tropical Japonica | 504 | 97.20% | 0.20% | 1.39% | 1.19% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.00% | 4.15% | 3.32% | NA |
| VI/Aromatic | 96 | 39.60% | 0.00% | 39.58% | 20.83% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 32.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406728056 | C -> DEL | N | N | silent_mutation | Average:8.225; most accessible tissue: Callus, score: 22.59 | N | N | N | N |
| vg0406728056 | C -> T | LOC_Os04g12200-LOC_Os04g12220 | intergenic_region ; MODIFIER | silent_mutation | Average:8.225; most accessible tissue: Callus, score: 22.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406728056 | NA | 9.19E-94 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 7.23E-86 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.19E-80 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 2.19E-99 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 2.93E-99 | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.01E-92 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 3.95E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.82E-85 | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 9.73E-99 | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 3.16E-70 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.04E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | 2.94E-06 | 1.57E-116 | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.10E-114 | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 4.36E-107 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | 2.09E-06 | 1.46E-122 | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | 1.53E-08 | 4.59E-74 | mr1402_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 7.72E-133 | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 4.33E-108 | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 2.63E-32 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 1.78E-86 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406728056 | NA | 3.87E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |