\
| Variant ID: vg0406719900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6719900 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.34, others allele: 0.00, population size: 35. )
GTCAAAAAAGTGCCTATATTTAGTTTGCTGTCAAACTTTAGTAAATATATAAAAAATCCTGCCAAAAATTTTGGGAATATTGTCAATTTATCAAAATTTT[T/G]
GTATCACCAAAATTTGGTAAGGTTTATTTTAGCTACAATCTCAACAACCCCTAAATTAATTCCTACTTACTTGATGATGGAGCGTGCTTGTGATGGCTGG
CCAGCCATCACAAGCACGCTCCATCATCAAGTAAGTAGGAATTAATTTAGGGGTTGTTGAGATTGTAGCTAAAATAAACCTTACCAAATTTTGGTGATAC[A/C]
AAAATTTTGATAAATTGACAATATTCCCAAAATTTTTGGCAGGATTTTTTATATATTTACTAAAGTTTGACAGCAAACTAAATATAGGCACTTTTTTGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 31.00% | 0.53% | 33.47% | NA |
| All Indica | 2759 | 5.20% | 49.90% | 0.72% | 44.11% | NA |
| All Japonica | 1512 | 94.50% | 1.90% | 0.07% | 3.51% | NA |
| Aus | 269 | 6.70% | 1.10% | 0.37% | 91.82% | NA |
| Indica I | 595 | 7.90% | 74.50% | 0.17% | 17.48% | NA |
| Indica II | 465 | 4.90% | 25.80% | 1.51% | 67.74% | NA |
| Indica III | 913 | 1.60% | 50.50% | 0.55% | 47.32% | NA |
| Indica Intermediate | 786 | 7.50% | 45.00% | 0.89% | 46.56% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 0.13% | 3.39% | NA |
| Tropical Japonica | 504 | 94.00% | 4.00% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 90.00% | 2.90% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 22.90% | 37.50% | 0.00% | 39.58% | NA |
| Intermediate | 90 | 46.70% | 20.00% | 3.33% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406719900 | T -> DEL | N | N | silent_mutation | Average:10.075; most accessible tissue: Callus, score: 49.176 | N | N | N | N |
| vg0406719900 | T -> G | LOC_Os04g12190.1 | downstream_gene_variant ; 3513.0bp to feature; MODIFIER | silent_mutation | Average:10.075; most accessible tissue: Callus, score: 49.176 | N | N | N | N |
| vg0406719900 | T -> G | LOC_Os04g12200.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.075; most accessible tissue: Callus, score: 49.176 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406719900 | NA | 2.33E-22 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.47E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.14E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 7.80E-17 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 8.76E-17 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.61E-16 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | 1.18E-06 | 1.18E-06 | mr1367 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 2.89E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.17E-14 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 6.94E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 5.86E-16 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.80E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 2.26E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 6.19E-18 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 5.34E-15 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 1.20E-20 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 9.11E-17 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406719900 | NA | 7.71E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |