\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406719567:

Variant ID: vg0406719567 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6719567
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTACATAGGTATCATGAGGTACCAAATTTATACAATAAAAAAAATGGTACTTCATGGTATCTCCTCAAAGACCGTAAAATTGCTTTAATTTATAGTAAT[C/T]
AATATATATTATTACCAGTATATATGGAGAAGGTTATATTAATATTTTACATGTAGAGACTTAGTGGCCGCGGTGAATGGTGGGGAGCTAGGTGCCATTG

Reverse complement sequence

CAATGGCACCTAGCTCCCCACCATTCACCGCGGCCACTAAGTCTCTACATGTAAAATATTAATATAACCTTCTCCATATATACTGGTAATAATATATATT[G/A]
ATTACTATAAATTAAAGCAATTTTACGGTCTTTGAGGAGATACCATGAAGTACCATTTTTTTTATTGTATAAATTTGGTACCTCATGATACCTATGTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 27.40% 0.68% 33.37% NA
All Indica  2759 9.50% 45.40% 1.01% 44.04% NA
All Japonica  1512 94.80% 1.70% 0.07% 3.44% NA
Aus  269 7.40% 0.70% 0.37% 91.45% NA
Indica I  595 8.10% 74.60% 0.17% 17.14% NA
Indica II  465 5.80% 23.90% 2.80% 67.53% NA
Indica III  913 12.90% 39.40% 0.66% 46.99% NA
Indica Intermediate  786 8.90% 43.00% 1.02% 47.07% NA
Temperate Japonica  767 96.50% 0.10% 0.13% 3.26% NA
Tropical Japonica  504 94.00% 4.00% 0.00% 1.98% NA
Japonica Intermediate  241 90.90% 2.10% 0.00% 7.05% NA
VI/Aromatic  96 59.40% 1.00% 0.00% 39.58% NA
Intermediate  90 55.60% 13.30% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406719567 C -> DEL N N silent_mutation Average:19.312; most accessible tissue: Callus, score: 72.368 N N N N
vg0406719567 C -> T LOC_Os04g12190.1 downstream_gene_variant ; 3180.0bp to feature; MODIFIER silent_mutation Average:19.312; most accessible tissue: Callus, score: 72.368 N N N N
vg0406719567 C -> T LOC_Os04g12200.1 intron_variant ; MODIFIER silent_mutation Average:19.312; most accessible tissue: Callus, score: 72.368 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406719567 NA 8.45E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 7.10E-22 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 6.84E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 5.33E-17 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 3.37E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 4.87E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 1.52E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 2.96E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 1.04E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 1.02E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 5.72E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 1.04E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 2.66E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 2.25E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 7.63E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 3.87E-06 3.13E-19 mr1950 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 4.33E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 2.05E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 9.08E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406719567 NA 8.41E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251