Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406717258:

Variant ID: vg0406717258 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6717258
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTCGACTAGGCGGCGGCGGATGCAGAGCTTGAGCTCGATCTCGTCCTTGACCAAGCGGTGGCGGCGCTCGATATTGTTCTTGAGAGAAGGGGAAGGTT[G/C]
GCCGCGGCCACGACAAGGTCGGTAGTGAGATTGATGCGGAGCCCACCATCTTGGCCATGCTCGGGAGAAGAGGGAGGTTGGTGGCGAGCTCGATGAGGAG

Reverse complement sequence

CTCCTCATCGAGCTCGCCACCAACCTCCCTCTTCTCCCGAGCATGGCCAAGATGGTGGGCTCCGCATCAATCTCACTACCGACCTTGTCGTGGCCGCGGC[C/G]
AACCTTCCCCTTCTCTCAAGAACAATATCGAGCGCCGCCACCGCTTGGTCAAGGACGAGATCGAGCTCAAGCTCTGCATCCGCCGCCGCCTAGTCGAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 26.00% 1.40% 1.71% NA
All Indica  2759 54.40% 41.50% 2.10% 2.07% NA
All Japonica  1512 97.80% 1.80% 0.00% 0.40% NA
Aus  269 98.50% 0.70% 0.37% 0.37% NA
Indica I  595 25.70% 71.30% 1.01% 2.02% NA
Indica II  465 75.10% 22.80% 0.86% 1.29% NA
Indica III  913 60.50% 34.20% 3.50% 1.86% NA
Indica Intermediate  786 56.70% 38.40% 2.04% 2.80% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 95.60% 4.00% 0.00% 0.40% NA
Japonica Intermediate  241 95.90% 2.90% 0.00% 1.24% NA
VI/Aromatic  96 37.50% 37.50% 7.29% 17.71% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406717258 G -> C LOC_Os04g12190.1 downstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:70.387; most accessible tissue: Minghui63 young leaf, score: 89.557 N N N N
vg0406717258 G -> C LOC_Os04g12200.1 downstream_gene_variant ; 1299.0bp to feature; MODIFIER silent_mutation Average:70.387; most accessible tissue: Minghui63 young leaf, score: 89.557 N N N N
vg0406717258 G -> C LOC_Os04g12190-LOC_Os04g12200 intergenic_region ; MODIFIER silent_mutation Average:70.387; most accessible tissue: Minghui63 young leaf, score: 89.557 N N N N
vg0406717258 G -> DEL N N silent_mutation Average:70.387; most accessible tissue: Minghui63 young leaf, score: 89.557 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406717258 G C -0.01 -0.01 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406717258 NA 9.44E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 8.63E-07 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 4.67E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 4.04E-07 mr1573 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 1.02E-08 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 2.98E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 6.39E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 6.47E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406717258 NA 3.19E-16 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251