Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406710690:

Variant ID: vg0406710690 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6710690
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTAGTTTTTCTTCTTTCAAGCAAACACCAAGTAACCGCACCAAGTTTTTGTGCTCGAGCTTGGCAGCTAGAACAAGATCATTTTTCAGTTCATGAAA[T/C]
CCCTGTGAGGAGGTTGTTGAAAGCCGTTTCACTGCTATTTCTTCCCCGTCCTCAAGTGTACCCTGCAAAAATAAATTATTTTGCTGCTTAGCTGTAGTGA

Reverse complement sequence

TCACTACAGCTAAGCAGCAAAATAATTTATTTTTGCAGGGTACACTTGAGGACGGGGAAGAAATAGCAGTGAAACGGCTTTCAACAACCTCCTCACAGGG[A/G]
TTTCATGAACTGAAAAATGATCTTGTTCTAGCTGCCAAGCTCGAGCACAAAAACTTGGTGCGGTTACTTGGTGTTTGCTTGAAAGAAGAAAAACTACTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	35.10%	0.34%	22.92%	NA
All Indica	2759	66.20%	5.10%	0.54%	28.09%	NA
All Japonica	1512	4.60%	94.60%	0.00%	0.86%	NA
Aus	269	4.10%	7.10%	0.37%	88.48%	NA
Indica I	595	81.00%	8.10%	0.17%	10.76%	NA
Indica II	465	38.50%	4.90%	1.72%	54.84%	NA
Indica III	913	71.30%	1.60%	0.33%	26.73%	NA
Indica Intermediate	786	65.50%	7.10%	0.38%	26.97%	NA
Temperate Japonica	767	3.10%	96.20%	0.00%	0.65%	NA
Tropical Japonica	504	5.20%	94.00%	0.00%	0.79%	NA
Japonica Intermediate	241	7.90%	90.50%	0.00%	1.66%	NA
VI/Aromatic	96	37.50%	24.00%	0.00%	38.54%	NA
Intermediate	90	30.00%	47.80%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406710690	T -> C	LOC_Os04g12180.1	synonymous_variant ; p.Gly48Gly; LOW	synonymous_codon	Average:35.45; most accessible tissue: Callus, score: 76.849	N	N	N	N
vg0406710690	T -> DEL	LOC_Os04g12180.1	N	frameshift_variant	Average:35.45; most accessible tissue: Callus, score: 76.849	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406710690	NA	1.00E-16	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.96E-09	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	6.68E-18	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.19E-09	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.72E-17	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.01E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.34E-06	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	9.46E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	4.09E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	3.33E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.39E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.51E-16	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.61E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.28E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.95E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.00E-08	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.27E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.58E-07	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.70E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.83E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.82E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.82E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.06E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.63E-09	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.40E-10	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.68E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	4.24E-10	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.80E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	3.61E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	9.46E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	3.06E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.09E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.30E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.44E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	3.74E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	3.30E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	1.23E-06	2.44E-08	mr1748_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	5.42E-11	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.32E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.48E-09	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	2.06E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.10E-08	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.88E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406710690	NA	1.88E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251