Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406708392:

Variant ID: vg0406708392 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 6708392
Reference Allele: C	Alternative Allele: T,CTGT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCGCCCAATGGAGAAGGTATAAACATGTCATGCTCATCTTCATCTTCCTGATTATG[C/T,CTGT]
GCACCACTTCTGACTGCTGCTGCTCCACTTCCTGATTCTTACTCTCCATGCTTCACCCAACATGTATAGCCCTTCATGAATCCTCGTTGTATCATATGAC

Reverse complement sequence

GTCATATGATACAACGAGGATTCATGAAGGGCTATACATGTTGGGTGAAGCATGGAGAGTAAGAATCAGGAAGTGGAGCAGCAGCAGTCAGAAGTGGTGC[G/A,ACAG]
CATAATCAGGAAGATGAAGATGAGCATGACATGTTTATACCTTCTCCATTGGGCGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	25.50%	8.55%	1.40%	NA
All Indica	2759	50.60%	39.50%	9.03%	0.87%	NA
All Japonica	1512	98.90%	0.50%	0.46%	0.13%	NA
Aus	269	12.30%	30.10%	44.98%	12.64%	NA
Indica I	595	82.20%	13.40%	4.03%	0.34%	NA
Indica II	465	29.00%	55.90%	13.12%	1.94%	NA
Indica III	913	40.70%	47.80%	10.95%	0.55%	NA
Indica Intermediate	786	50.90%	39.90%	8.14%	1.02%	NA
Temperate Japonica	767	99.50%	0.10%	0.39%	0.00%	NA
Tropical Japonica	504	98.40%	1.20%	0.20%	0.20%	NA
Japonica Intermediate	241	97.90%	0.40%	1.24%	0.41%	NA
VI/Aromatic	96	63.50%	6.20%	25.00%	5.21%	NA
Intermediate	90	71.10%	24.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406708392	C -> DEL	N	N	silent_mutation	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> CTGT	LOC_Os04g12160.1	downstream_gene_variant ; 3965.0bp to feature; MODIFIER	N	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> CTGT	LOC_Os04g12180.1	downstream_gene_variant ; 828.0bp to feature; MODIFIER	N	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> CTGT	LOC_Os04g12170.1	intron_variant ; MODIFIER	N	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> T	LOC_Os04g12160.1	downstream_gene_variant ; 3964.0bp to feature; MODIFIER	silent_mutation	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> T	LOC_Os04g12180.1	downstream_gene_variant ; 829.0bp to feature; MODIFIER	silent_mutation	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0406708392	C -> T	LOC_Os04g12170.1	intron_variant ; MODIFIER	silent_mutation	Average:22.883; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406708392	NA	7.70E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406708392	9.14E-06	NA	mr1036	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406708392	NA	8.41E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406708392	NA	7.78E-07	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406708392	NA	6.77E-07	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406708392	9.99E-07	3.14E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251