\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406706214:

Variant ID: vg0406706214 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6706214
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, A: 0.18, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCAGATTTTCGCTAAGTGCTCCTCAAAGTATGGGCCAACTTCTGCCATATGTTGGAGCACAGCGTAATGAGCCTGCGCGTAGGATGCTTGATCGGGC[A/C]
TAATTCTTTTTCTTCCAATTGTGCCAACACCTGACAACCTTCCCTCGTGACGAGACGCAGGAACTCCGATAGGATCAGCATCGGACATGTTATTGACACA

Reverse complement sequence

TGTGTCAATAACATGTCCGATGCTGATCCTATCGGAGTTCCTGCGTCTCGTCACGAGGGAAGGTTGTCAGGTGTTGGCACAATTGGAAGAAAAAGAATTA[T/G]
GCCCGATCAAGCATCCTACGCGCAGGCTCATTACGCTGTGCTCCAACATATGGCAGAAGTTGGCCCATACTTTGAGGAGCACTTAGCGAAAATCTGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 35.10% 0.40% 24.10% NA
All Indica  2759 64.00% 5.30% 0.58% 30.16% NA
All Japonica  1512 4.80% 94.40% 0.00% 0.86% NA
Aus  269 3.70% 6.70% 0.37% 89.22% NA
Indica I  595 81.20% 8.40% 0.17% 10.25% NA
Indica II  465 38.70% 4.30% 0.65% 56.34% NA
Indica III  913 65.30% 1.60% 0.88% 32.20% NA
Indica Intermediate  786 64.40% 7.80% 0.51% 27.35% NA
Temperate Japonica  767 3.10% 96.30% 0.00% 0.52% NA
Tropical Japonica  504 5.20% 94.00% 0.00% 0.79% NA
Japonica Intermediate  241 9.10% 88.80% 0.00% 2.07% NA
VI/Aromatic  96 37.50% 24.00% 0.00% 38.54% NA
Intermediate  90 30.00% 48.90% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406706214 A -> C LOC_Os04g12170.1 missense_variant ; p.Met487Arg; MODERATE nonsynonymous_codon ; M487R Average:14.214; most accessible tissue: Minghui63 flag leaf, score: 28.142 probably damaging -2.068 TOLERATED 1.00
vg0406706214 A -> DEL LOC_Os04g12170.1 N frameshift_variant Average:14.214; most accessible tissue: Minghui63 flag leaf, score: 28.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406706214 NA 3.95E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.26E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.17E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 2.47E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 7.52E-08 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 3.66E-07 1.76E-13 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 2.87E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 3.65E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.15E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 2.80E-07 mr1835 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.34E-12 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 2.79E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 3.43E-08 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 7.54E-10 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 2.99E-09 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 1.89E-06 3.90E-10 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 7.54E-06 2.04E-13 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 3.04E-08 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 4.01E-09 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.61E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406706214 NA 1.74E-09 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251