\
| Variant ID: vg0406639350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6639350 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.30, others allele: 0.00, population size: 80. )
TTGGTTATCACTATTTGCGTAAAGGCCGTTGTGAACATCTTTTAGTTTAAAATAGTAAAATAGTTGATTATTTAAGGCAAGATTAATCTTCACTAAACAA[T/C]
GCTACACCACGTTGAACATTCCAACCAAACCACCTGAACTACACCAGTTCACTAAGTCAAATTAATTAATACAATGAGACTAACCATAGTGAAGTTGGTC
GACCAACTTCACTATGGTTAGTCTCATTGTATTAATTAATTTGACTTAGTGAACTGGTGTAGTTCAGGTGGTTTGGTTGGAATGTTCAACGTGGTGTAGC[A/G]
TTGTTTAGTGAAGATTAATCTTGCCTTAAATAATCAACTATTTTACTATTTTAAACTAAAAGATGTTCACAACGGCCTTTACGCAAATAGTGATAACCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 24.10% | 0.63% | 16.86% | NA |
| All Indica | 2759 | 42.70% | 31.60% | 0.94% | 24.76% | NA |
| All Japonica | 1512 | 96.70% | 2.80% | 0.13% | 0.40% | NA |
| Aus | 269 | 2.60% | 70.30% | 0.37% | 26.77% | NA |
| Indica I | 595 | 75.10% | 7.70% | 0.17% | 16.97% | NA |
| Indica II | 465 | 38.30% | 52.30% | 0.22% | 9.25% | NA |
| Indica III | 913 | 28.40% | 32.20% | 1.31% | 38.12% | NA |
| Indica Intermediate | 786 | 37.40% | 36.80% | 1.53% | 24.30% | NA |
| Temperate Japonica | 767 | 98.30% | 1.30% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 94.40% | 5.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 56.20% | 14.60% | 1.04% | 28.12% | NA |
| Intermediate | 90 | 66.70% | 23.30% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406639350 | T -> C | LOC_Os04g12080.1 | downstream_gene_variant ; 504.0bp to feature; MODIFIER | silent_mutation | Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0406639350 | T -> C | LOC_Os04g12080-LOC_Os04g12090 | intergenic_region ; MODIFIER | silent_mutation | Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0406639350 | T -> DEL | N | N | silent_mutation | Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406639350 | NA | 4.27E-15 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | 2.73E-06 | 2.98E-10 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 6.62E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 3.44E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 5.01E-06 | mr1525 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | 2.34E-06 | 2.33E-06 | mr1827 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 5.21E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 1.09E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 4.41E-19 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406639350 | NA | 1.88E-09 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |