\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406639350:

Variant ID: vg0406639350 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6639350
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.30, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTTATCACTATTTGCGTAAAGGCCGTTGTGAACATCTTTTAGTTTAAAATAGTAAAATAGTTGATTATTTAAGGCAAGATTAATCTTCACTAAACAA[T/C]
GCTACACCACGTTGAACATTCCAACCAAACCACCTGAACTACACCAGTTCACTAAGTCAAATTAATTAATACAATGAGACTAACCATAGTGAAGTTGGTC

Reverse complement sequence

GACCAACTTCACTATGGTTAGTCTCATTGTATTAATTAATTTGACTTAGTGAACTGGTGTAGTTCAGGTGGTTTGGTTGGAATGTTCAACGTGGTGTAGC[A/G]
TTGTTTAGTGAAGATTAATCTTGCCTTAAATAATCAACTATTTTACTATTTTAAACTAAAAGATGTTCACAACGGCCTTTACGCAAATAGTGATAACCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 24.10% 0.63% 16.86% NA
All Indica  2759 42.70% 31.60% 0.94% 24.76% NA
All Japonica  1512 96.70% 2.80% 0.13% 0.40% NA
Aus  269 2.60% 70.30% 0.37% 26.77% NA
Indica I  595 75.10% 7.70% 0.17% 16.97% NA
Indica II  465 38.30% 52.30% 0.22% 9.25% NA
Indica III  913 28.40% 32.20% 1.31% 38.12% NA
Indica Intermediate  786 37.40% 36.80% 1.53% 24.30% NA
Temperate Japonica  767 98.30% 1.30% 0.26% 0.13% NA
Tropical Japonica  504 94.40% 5.20% 0.00% 0.40% NA
Japonica Intermediate  241 96.30% 2.50% 0.00% 1.24% NA
VI/Aromatic  96 56.20% 14.60% 1.04% 28.12% NA
Intermediate  90 66.70% 23.30% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406639350 T -> C LOC_Os04g12080.1 downstream_gene_variant ; 504.0bp to feature; MODIFIER silent_mutation Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0406639350 T -> C LOC_Os04g12080-LOC_Os04g12090 intergenic_region ; MODIFIER silent_mutation Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0406639350 T -> DEL N N silent_mutation Average:40.76; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406639350 NA 4.27E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 2.73E-06 2.98E-10 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 6.62E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 3.44E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 5.01E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 2.34E-06 2.33E-06 mr1827 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 5.21E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 1.09E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 4.41E-19 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406639350 NA 1.88E-09 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251