\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406633967:

Variant ID: vg0406633967 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6633967
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.38, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTAAAATAATTTATTTTAGTTTTCGTTCAAACTAAAATAAAAGCATATATCATTTTGATTGGGTTATCAATTGCTCAGCCCACAGAAAACCGTCAT[C/T]
GGTGCACAAACAAAATCAACTCAGCACGGTCTATCACATTCGCCTCTTCTCTCGATCTTTCTGCTCTTGTTCTTTCTTAGTTTTCCGGCGGTTCTATCTC

Reverse complement sequence

GAGATAGAACCGCCGGAAAACTAAGAAAGAACAAGAGCAGAAAGATCGAGAGAAGAGGCGAATGTGATAGACCGTGCTGAGTTGATTTTGTTTGTGCACC[G/A]
ATGACGGTTTTCTGTGGGCTGAGCAATTGATAACCCAATCAAAATGATATATGCTTTTATTTTAGTTTGAACGAAAACTAAAATAAATTATTTTACAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 38.30% 0.17% 17.37% NA
All Indica  2759 63.70% 10.50% 0.29% 25.52% NA
All Japonica  1512 2.60% 97.00% 0.00% 0.40% NA
Aus  269 72.50% 0.00% 0.00% 27.51% NA
Indica I  595 81.70% 0.80% 0.34% 17.14% NA
Indica II  465 82.60% 7.70% 0.43% 9.25% NA
Indica III  913 39.60% 20.70% 0.33% 39.32% NA
Indica Intermediate  786 66.90% 7.50% 0.13% 25.45% NA
Temperate Japonica  767 3.00% 96.90% 0.00% 0.13% NA
Tropical Japonica  504 1.00% 98.60% 0.00% 0.40% NA
Japonica Intermediate  241 5.00% 93.80% 0.00% 1.24% NA
VI/Aromatic  96 57.30% 13.50% 0.00% 29.17% NA
Intermediate  90 43.30% 46.70% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406633967 C -> DEL N N silent_mutation Average:54.344; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg0406633967 C -> T LOC_Os04g12070.1 upstream_gene_variant ; 1284.0bp to feature; MODIFIER silent_mutation Average:54.344; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg0406633967 C -> T LOC_Os04g12080.1 upstream_gene_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:54.344; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg0406633967 C -> T LOC_Os04g12060.1 downstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:54.344; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N
vg0406633967 C -> T LOC_Os04g12070-LOC_Os04g12080 intergenic_region ; MODIFIER silent_mutation Average:54.344; most accessible tissue: Minghui63 panicle, score: 95.588 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406633967 C T -0.08 -0.04 -0.04 -0.05 -0.06 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406633967 NA 2.79E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 4.75E-14 1.65E-117 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 1.71E-06 3.39E-08 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 2.82E-09 3.08E-98 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 3.80E-11 1.54E-94 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 7.83E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 9.63E-13 1.63E-113 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 9.47E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 8.21E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 9.20E-12 1.59E-116 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 2.49E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 7.46E-12 1.79E-107 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 1.58E-38 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 2.26E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 6.48E-06 6.48E-06 mr1602 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 3.53E-09 4.33E-97 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 1.14E-13 1.04E-115 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 7.07E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 2.65E-76 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 2.07E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 2.15E-27 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 7.94E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 5.90E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 3.08E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 7.38E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 2.71E-06 6.39E-22 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 7.36E-63 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 1.31E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 8.25E-12 3.55E-130 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 1.44E-09 4.50E-123 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 1.50E-12 8.32E-121 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 1.54E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 2.78E-11 2.35E-132 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 1.16E-06 1.95E-72 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 7.25E-10 6.77E-149 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 2.98E-10 4.81E-118 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 1.08E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 3.29E-88 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 NA 5.35E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 7.28E-06 3.21E-38 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406633967 2.15E-06 2.07E-126 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251