\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406631705:

Variant ID: vg0406631705 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6631705
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.37, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTTTTTTTGCAAATCTTGGTTAAAAACCTGTAATTTCAAAGAGTTTTGGTCATGTCTTGCTCTGCCCATTGCTAAATTAGCAAGAATATAGCTGA[C/T]
AGCTTGATTCATATACATTAGCAGTTAAACAAGGTAGCAGGATAATTAAACCCTATTATGGCAAAGTTTTTTTTGGTCAAGTCTTGCTTTATGAAAGTGA

Reverse complement sequence

TCACTTTCATAAAGCAAGACTTGACCAAAAAAAACTTTGCCATAATAGGGTTTAATTATCCTGCTACCTTGTTTAACTGCTAATGTATATGAATCAAGCT[G/A]
TCAGCTATATTCTTGCTAATTTAGCAATGGGCAGAGCAAGACATGACCAAAACTCTTTGAAATTACAGGTTTTTAACCAAGATTTGCAAAAAAAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 40.10% 0.15% 17.65% NA
All Indica  2759 60.20% 13.60% 0.25% 25.99% NA
All Japonica  1512 2.60% 97.00% 0.00% 0.40% NA
Aus  269 72.50% 0.00% 0.00% 27.51% NA
Indica I  595 81.50% 1.00% 0.17% 17.31% NA
Indica II  465 66.90% 23.00% 0.22% 9.89% NA
Indica III  913 39.10% 20.60% 0.22% 40.09% NA
Indica Intermediate  786 64.60% 9.30% 0.38% 25.70% NA
Temperate Japonica  767 3.00% 96.90% 0.00% 0.13% NA
Tropical Japonica  504 1.20% 98.40% 0.00% 0.40% NA
Japonica Intermediate  241 4.60% 94.20% 0.00% 1.24% NA
VI/Aromatic  96 57.30% 13.50% 0.00% 29.17% NA
Intermediate  90 42.20% 47.80% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406631705 C -> DEL N N silent_mutation Average:48.199; most accessible tissue: Callus, score: 96.89 N N N N
vg0406631705 C -> T LOC_Os04g12080.1 upstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:48.199; most accessible tissue: Callus, score: 96.89 N N N N
vg0406631705 C -> T LOC_Os04g12060.1 downstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:48.199; most accessible tissue: Callus, score: 96.89 N N N N
vg0406631705 C -> T LOC_Os04g12070.1 downstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:48.199; most accessible tissue: Callus, score: 96.89 N N N N
vg0406631705 C -> T LOC_Os04g12060-LOC_Os04g12070 intergenic_region ; MODIFIER silent_mutation Average:48.199; most accessible tissue: Callus, score: 96.89 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406631705 C T -0.12 -0.03 -0.02 -0.04 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406631705 3.85E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 9.20E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 1.30E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 2.94E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 6.00E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 4.66E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 3.86E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 4.17E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 3.98E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 2.35E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 5.16E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 8.31E-10 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 2.39E-08 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 1.93E-08 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 7.67E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 9.56E-09 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 1.06E-08 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 NA 1.17E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 1.23E-08 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 7.97E-08 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 7.48E-06 NA mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 5.26E-11 9.86E-39 mr1913_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406631705 9.22E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251