\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406620420:

Variant ID: vg0406620420 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6620420
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCGGTGTTGGTAATTTCAGCTTTCTTTGATTTTCCCGTAGTGGTATGTACTTTGACACCATGTAGTTTACTATGTTGGCATACCATGGGTTGGAGTC[G/A]
CGCACCATCATTAGCATGTCATCTCTCAAGAAATCATTTATTGGCTGTTCCTGTGCATCAGTAATTCGTAGCTAGACAAATGATCCGCTACGGAATTTTC

Reverse complement sequence

GAAAATTCCGTAGCGGATCATTTGTCTAGCTACGAATTACTGATGCACAGGAACAGCCAATAAATGATTTCTTGAGAGATGACATGCTAATGATGGTGCG[C/T]
GACTCCAACCCATGGTATGCCAACATAGTAAACTACATGGTGTCAAAGTACATACCACTACGGGAAAATCAAAGAAAGCTGAAATTACCAACACCGGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 10.80% 0.63% 16.74% NA
All Indica  2759 58.00% 16.40% 1.09% 24.50% NA
All Japonica  1512 99.20% 0.50% 0.00% 0.33% NA
Aus  269 72.50% 0.40% 0.00% 27.14% NA
Indica I  595 76.60% 6.20% 0.67% 16.47% NA
Indica II  465 78.30% 13.10% 1.08% 7.53% NA
Indica III  913 38.70% 21.60% 1.10% 38.66% NA
Indica Intermediate  786 54.50% 20.00% 1.40% 24.17% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.83% NA
VI/Aromatic  96 32.30% 38.50% 0.00% 29.17% NA
Intermediate  90 73.30% 16.70% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406620420 G -> DEL N N silent_mutation Average:27.819; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0406620420 G -> A LOC_Os04g12050.1 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:27.819; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0406620420 G -> A LOC_Os04g12040-LOC_Os04g12050 intergenic_region ; MODIFIER silent_mutation Average:27.819; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406620420 NA 5.85E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 6.25E-07 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 7.82E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 1.14E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 5.60E-07 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 8.62E-06 NA mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 3.67E-06 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 3.00E-09 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 1.84E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 6.74E-08 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 1.45E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 1.04E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 1.16E-06 6.09E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 3.30E-06 3.30E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 8.32E-06 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 3.54E-06 NA mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 9.45E-06 9.45E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 6.51E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406620420 NA 9.27E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251