\
| Variant ID: vg0406579445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6579445 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 105. )
TCTCTAGATCTGGTGATGGCGGCGGCCATGGAGAAGACCGGATGAGGTGGTGGCTGGCGGGCGGTTGGTGGCCAAGATTCTTTTTCCTTTTTCGTTTGTT[T/C]
AAAATTATAGGTGCCAGTTTCAGAATCAATTGGTGTCAGGCCTAAAACCGGCATCTATGAGGCCTTTGGAACCGGCATCAATGAGTATTTCTGTGGCAGT
ACTGCCACAGAAATACTCATTGATGCCGGTTCCAAAGGCCTCATAGATGCCGGTTTTAGGCCTGACACCAATTGATTCTGAAACTGGCACCTATAATTTT[A/G]
AACAAACGAAAAAGGAAAAAGAATCTTGGCCACCAACCGCCCGCCAGCCACCACCTCATCCGGTCTTCTCCATGGCCGCCGCCATCACCAGATCTAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406579445 | T -> C | LOC_Os04g11990.1 | upstream_gene_variant ; 72.0bp to feature; MODIFIER | silent_mutation | Average:75.751; most accessible tissue: Callus, score: 89.938 | N | N | N | N |
| vg0406579445 | T -> C | LOC_Os04g11990-LOC_Os04g12000 | intergenic_region ; MODIFIER | silent_mutation | Average:75.751; most accessible tissue: Callus, score: 89.938 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406579445 | NA | 3.30E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.51E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 3.31E-12 | 7.07E-111 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 2.08E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 3.66E-08 | 4.86E-95 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 7.74E-09 | 9.69E-87 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 3.98E-11 | 6.33E-106 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.37E-12 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 2.12E-09 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 2.42E-10 | 9.82E-109 | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.25E-22 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 2.14E-09 | 9.52E-99 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 2.79E-10 | 6.99E-99 | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 7.32E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 7.02E-11 | 5.59E-105 | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 8.38E-72 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 2.09E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.93E-09 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.26E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 2.76E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 7.24E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 5.42E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 6.32E-06 | 1.04E-19 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.49E-59 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.92E-17 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.19E-14 | 1.85E-128 | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 6.02E-12 | 1.95E-121 | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.43E-11 | 1.24E-112 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 4.59E-17 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 3.18E-21 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.08E-14 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.92E-13 | 1.16E-127 | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 5.70E-64 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 2.43E-35 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 5.04E-14 | 9.53E-150 | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 3.03E-08 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.41E-09 | 4.21E-112 | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 4.45E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.97E-19 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.41E-09 | 1.37E-35 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | 1.58E-07 | 3.71E-128 | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406579445 | NA | 1.60E-20 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |