\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406562314:

Variant ID: vg0406562314 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6562314
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGGGCGGCAGCCTGTTCCAAGCGTGTTGACGAAAAAATCGAATACACCGGCCTGGGAGATCTGCTTAACTCCTGTGCAGGTCCAAAAATTGGTGAGAT[A/G]
CGAGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAGTAGATCAAAACAGACGATCGACTGACAAGCCGATGGAGTAGTTCCAGCCGA

Reverse complement sequence

TCGGCTGGAACTACTCCATCGGCTTGTCAGTCGATCGTCTGTTTTGATCTACTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCTCG[T/C]
ATCTCACCAATTTTTGGACCTGCACAGGAGTTAAGCAGATCTCCCAGGCCGGTGTATTCGATTTTTTCGTCAACACGCTTGGAACAGGCTGCCGCCCTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 32.00% 4.38% 11.05% NA
All Indica  2759 78.90% 1.50% 4.86% 14.75% NA
All Japonica  1512 4.90% 93.90% 0.99% 0.20% NA
Aus  269 52.80% 0.40% 15.99% 30.86% NA
Indica I  595 78.70% 0.80% 3.53% 16.97% NA
Indica II  465 73.30% 3.00% 5.16% 18.49% NA
Indica III  913 85.00% 0.50% 4.49% 9.97% NA
Indica Intermediate  786 75.20% 2.30% 6.11% 16.41% NA
Temperate Japonica  767 3.70% 94.70% 1.69% 0.00% NA
Tropical Japonica  504 5.80% 93.80% 0.20% 0.20% NA
Japonica Intermediate  241 7.10% 91.70% 0.41% 0.83% NA
VI/Aromatic  96 56.20% 14.60% 7.29% 21.88% NA
Intermediate  90 42.20% 40.00% 8.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406562314 A -> DEL N N silent_mutation Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg0406562314 A -> G LOC_Os04g11956.1 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg0406562314 A -> G LOC_Os04g11962.1 upstream_gene_variant ; 1540.0bp to feature; MODIFIER silent_mutation Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg0406562314 A -> G LOC_Os04g11970.1 upstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg0406562314 A -> G LOC_Os04g11962-LOC_Os04g11970 intergenic_region ; MODIFIER silent_mutation Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406562314 NA 1.30E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0406562314 7.82E-06 7.82E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 1.30E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 3.95E-14 2.34E-114 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.57E-14 1.59E-20 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.76E-10 1.89E-98 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 3.76E-11 3.20E-16 mr1080 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.32E-11 3.67E-91 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.42E-16 8.80E-23 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.65E-14 1.85E-114 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.27E-16 4.11E-23 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.79E-12 8.82E-116 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.67E-15 4.56E-21 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 4.53E-13 9.43E-108 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 3.05E-16 2.57E-22 mr1395 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 1.45E-38 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 9.20E-07 9.20E-07 mr1402 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.26E-12 7.93E-99 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 4.98E-25 1.73E-35 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 5.41E-14 8.55E-114 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.14E-15 3.10E-21 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 9.87E-08 5.75E-78 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 7.53E-14 1.13E-18 mr1619 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 1.58E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.69E-08 1.69E-08 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 8.29E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 9.34E-06 9.74E-21 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.33E-09 1.98E-20 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 8.78E-06 1.46E-63 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.02E-15 3.17E-18 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 1.37E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 4.13E-15 3.48E-130 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 3.31E-14 1.62E-20 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.67E-11 2.21E-121 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.11E-12 8.30E-18 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.31E-11 3.59E-114 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 5.73E-16 9.78E-24 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 6.66E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 7.90E-15 4.82E-134 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.21E-15 6.93E-22 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 7.01E-07 2.58E-71 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 3.91E-09 2.26E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 8.09E-17 3.82E-148 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 5.23E-21 7.59E-35 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 2.47E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 8.92E-10 4.97E-112 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 5.67E-12 3.67E-16 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 NA 9.92E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 9.45E-06 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.62E-08 5.53E-14 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 5.22E-08 3.63E-35 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 1.25E-17 7.90E-29 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.08E-09 5.41E-125 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406562314 2.90E-12 8.55E-22 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251