| Variant ID: vg0406562314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6562314 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )
GTAGGGCGGCAGCCTGTTCCAAGCGTGTTGACGAAAAAATCGAATACACCGGCCTGGGAGATCTGCTTAACTCCTGTGCAGGTCCAAAAATTGGTGAGAT[A/G]
CGAGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAGTAGATCAAAACAGACGATCGACTGACAAGCCGATGGAGTAGTTCCAGCCGA
TCGGCTGGAACTACTCCATCGGCTTGTCAGTCGATCGTCTGTTTTGATCTACTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCTCG[T/C]
ATCTCACCAATTTTTGGACCTGCACAGGAGTTAAGCAGATCTCCCAGGCCGGTGTATTCGATTTTTTCGTCAACACGCTTGGAACAGGCTGCCGCCCTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 32.00% | 4.38% | 11.05% | NA |
| All Indica | 2759 | 78.90% | 1.50% | 4.86% | 14.75% | NA |
| All Japonica | 1512 | 4.90% | 93.90% | 0.99% | 0.20% | NA |
| Aus | 269 | 52.80% | 0.40% | 15.99% | 30.86% | NA |
| Indica I | 595 | 78.70% | 0.80% | 3.53% | 16.97% | NA |
| Indica II | 465 | 73.30% | 3.00% | 5.16% | 18.49% | NA |
| Indica III | 913 | 85.00% | 0.50% | 4.49% | 9.97% | NA |
| Indica Intermediate | 786 | 75.20% | 2.30% | 6.11% | 16.41% | NA |
| Temperate Japonica | 767 | 3.70% | 94.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 93.80% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.10% | 91.70% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 56.20% | 14.60% | 7.29% | 21.88% | NA |
| Intermediate | 90 | 42.20% | 40.00% | 8.89% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406562314 | A -> DEL | N | N | silent_mutation | Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0406562314 | A -> G | LOC_Os04g11956.1 | upstream_gene_variant ; 3440.0bp to feature; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0406562314 | A -> G | LOC_Os04g11962.1 | upstream_gene_variant ; 1540.0bp to feature; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0406562314 | A -> G | LOC_Os04g11970.1 | upstream_gene_variant ; 2311.0bp to feature; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0406562314 | A -> G | LOC_Os04g11962-LOC_Os04g11970 | intergenic_region ; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406562314 | NA | 1.30E-07 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0406562314 | 7.82E-06 | 7.82E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | NA | 1.30E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 3.95E-14 | 2.34E-114 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 1.57E-14 | 1.59E-20 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 1.76E-10 | 1.89E-98 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 3.76E-11 | 3.20E-16 | mr1080 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 2.32E-11 | 3.67E-91 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 2.42E-16 | 8.80E-23 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406562314 | 1.65E-14 | 1.85E-114 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/