Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406527932:

Variant ID: vg0406527932 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6527932
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCGACCAGGAGGTCTTCGCCTCTAATTCGCCATTTTGCAACCACATAGCTACATAAAAGGCGAACGCTTGATCGACGAAAACGCCAGGGGGGCGAAAC[G/A]
AATCGGCCGAAGCATCACTCGCCGAACGCTGAAACCGCGACAGCTTGTTTCGGAATAAAGATACGGAACGCCGTTGCATTCAACTTACGCAAAACACAAG

Reverse complement sequence

CTTGTGTTTTGCGTAAGTTGAATGCAACGGCGTTCCGTATCTTTATTCCGAAACAAGCTGTCGCGGTTTCAGCGTTCGGCGAGTGATGCTTCGGCCGATT[C/T]
GTTTCGCCCCCCTGGCGTTTTCGTCGATCAAGCGTTCGCCTTTTATGTAGCTATGTGGTTGCAAAATGGCGAATTAGAGGCGAAGACCTCCTGGTCGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	4.60%	0.00%	0.00%	NA
All Indica	2759	95.30%	4.70%	0.00%	0.00%	NA
All Japonica	1512	97.20%	2.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	89.00%	11.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	96.10%	3.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406527932	G -> A	LOC_Os04g11900.1	upstream_gene_variant ; 1574.0bp to feature; MODIFIER	silent_mutation	Average:21.611; most accessible tissue: Minghui63 flag leaf, score: 26.902	N	N	N	N
vg0406527932	G -> A	LOC_Os04g11910.1	upstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:21.611; most accessible tissue: Minghui63 flag leaf, score: 26.902	N	N	N	N
vg0406527932	G -> A	LOC_Os04g11900-LOC_Os04g11910	intergenic_region ; MODIFIER	silent_mutation	Average:21.611; most accessible tissue: Minghui63 flag leaf, score: 26.902	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406527932	4.69E-06	4.69E-06	mr1008	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.68E-13	2.20E-18	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.18E-10	5.97E-15	mr1080	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.02E-13	7.67E-19	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.86E-06	6.67E-06	mr1134	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.67E-14	6.75E-20	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	9.40E-13	4.65E-18	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	5.05E-13	5.41E-18	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.82E-07	6.84E-07	mr1504	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	5.07E-19	6.17E-26	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	7.34E-14	1.21E-18	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	3.23E-12	3.13E-15	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	4.51E-09	4.51E-09	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	3.37E-09	2.49E-21	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	3.95E-11	4.80E-13	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	2.54E-10	3.22E-17	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	3.34E-08	2.60E-14	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	7.03E-11	3.45E-19	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	4.25E-10	1.39E-17	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	2.12E-09	3.80E-13	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.31E-11	4.96E-30	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	6.04E-12	3.42E-16	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	2.43E-08	5.48E-14	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	1.72E-16	2.43E-31	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406527932	4.21E-08	9.55E-19	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251