| Variant ID: vg0406526555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6526555 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 78. )
TGGGGGCGAAAATAAGTTAAGGAGTTGCTCCCAAGAGCAGCCGAAAGAGATTTATCATTTTTCAAGATACTCCGAGGGGCCGGCAAACTCAATTGGACAC[C/T]
TGAGTGTCAAGCTGCCTTCAATGGGCTAAGGCAGTACCTTCGGCACTAGTGTAAATATCCGTTCGGAAAAACATTTTCTGCCGATTCAGTGTGCCGAAAG
CTTTCGGCACACTGAATCGGCAGAAAATGTTTTTCCGAACGGATATTTACACTAGTGCCGAAGGTACTGCCTTAGCCCATTGAAGGCAGCTTGACACTCA[G/A]
GTGTCCAATTGAGTTTGCCGGCCCCTCGGAGTATCTTGAAAAATGATAAATCTCTTTCGGCTGCTCTTGGGAGCAACTCCTTAACTTATTTTCGCCCCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.20% | 32.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 43.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406526555 | C -> T | LOC_Os04g11890.1 | upstream_gene_variant ; 4285.0bp to feature; MODIFIER | silent_mutation | Average:45.093; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0406526555 | C -> T | LOC_Os04g11900.1 | upstream_gene_variant ; 197.0bp to feature; MODIFIER | silent_mutation | Average:45.093; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0406526555 | C -> T | LOC_Os04g11910.1 | upstream_gene_variant ; 1990.0bp to feature; MODIFIER | silent_mutation | Average:45.093; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0406526555 | C -> T | LOC_Os04g11900-LOC_Os04g11910 | intergenic_region ; MODIFIER | silent_mutation | Average:45.093; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406526555 | NA | 2.50E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | NA | 5.71E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | NA | 1.92E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 3.08E-32 | 1.53E-142 | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 2.04E-12 | 4.15E-18 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 2.34E-22 | 1.51E-119 | mr1080 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 7.39E-09 | 9.32E-14 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 4.67E-20 | 5.86E-108 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | 4.04E-12 | 1.12E-18 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406526555 | NA | 2.36E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/