Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406498571:

Variant ID: vg0406498571 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6498571
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TGATATGACTTAATTAGAGGAAAAACTAAAAAATATAATTCGAACCATAGATTAATCATTTAAGCAATTACTAAGTGAGGATGAGCTATATAAGTATATA[T/G]
GATATCATAAAACATAATGAAGATATACATTGGAACATTATGTGAATTATGTTAGATGATAATTTAACATGTTTGTATTTGAAAAGCTCTTAAATTATAA

Reverse complement sequence

TTATAATTTAAGAGCTTTTCAAATACAAACATGTTAAATTATCATCTAACATAATTCACATAATGTTCCAATGTATATCTTCATTATGTTTTATGATATC[A/C]
TATATACTTATATAGCTCATCCTCACTTAGTAATTGCTTAAATGATTAATCTATGGTTCGAATTATATTTTTTAGTTTTTCCTCTAATTAAGTCATATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	26.80%	20.31%	21.01%	NA
All Indica	2759	1.20%	36.40%	30.26%	32.15%	NA
All Japonica	1512	93.80%	5.80%	0.20%	0.13%	NA
Aus	269	0.00%	30.50%	37.17%	32.34%	NA
Indica I	595	0.50%	25.20%	18.15%	56.13%	NA
Indica II	465	3.00%	32.00%	30.11%	34.84%	NA
Indica III	913	0.40%	43.60%	38.88%	17.09%	NA
Indica Intermediate	786	1.70%	38.90%	29.52%	29.90%	NA
Temperate Japonica	767	94.50%	5.20%	0.13%	0.13%	NA
Tropical Japonica	504	93.70%	6.00%	0.20%	0.20%	NA
Japonica Intermediate	241	92.10%	7.50%	0.41%	0.00%	NA
VI/Aromatic	96	15.60%	71.90%	7.29%	5.21%	NA
Intermediate	90	41.10%	28.90%	16.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406498571	T -> DEL	N	N	silent_mutation	Average:24.369; most accessible tissue: Callus, score: 41.069	N	N	N	N
vg0406498571	T -> G	LOC_Os04g11830.1	upstream_gene_variant ; 2946.0bp to feature; MODIFIER	silent_mutation	Average:24.369; most accessible tissue: Callus, score: 41.069	N	N	N	N
vg0406498571	T -> G	LOC_Os04g11850.1	upstream_gene_variant ; 3012.0bp to feature; MODIFIER	silent_mutation	Average:24.369; most accessible tissue: Callus, score: 41.069	N	N	N	N
vg0406498571	T -> G	LOC_Os04g11840.1	downstream_gene_variant ; 579.0bp to feature; MODIFIER	silent_mutation	Average:24.369; most accessible tissue: Callus, score: 41.069	N	N	N	N
vg0406498571	T -> G	LOC_Os04g11830-LOC_Os04g11840	intergenic_region ; MODIFIER	silent_mutation	Average:24.369; most accessible tissue: Callus, score: 41.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406498571	NA	5.27E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	NA	4.80E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	1.83E-06	7.02E-06	mr1312	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	NA	1.85E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	8.08E-06	8.08E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	NA	1.03E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406498571	NA	2.41E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251