| Variant ID: vg0406464503 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6464503 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, G: 0.17, others allele: 0.00, population size: 97. )
TAACTTATCAAGATCTACAACTTTCGTTTTGAACATTTTTCTATATGACTCTGTTTCAACAATTTGAATTTGAATTTCAAATTAGGACTACTTCAAACAA[G/C]
ATTTTGAAATAATAAATGATTTCAGCTGAAAAAGTCATCAACAACAAAGTTATATAACTCATCAAGATCTTTAACTTTTATTTTAGTCATTTCTTCATCC
GGATGAAGAAATGACTAAAATAAAAGTTAAAGATCTTGATGAGTTATATAACTTTGTTGTTGATGACTTTTTCAGCTGAAATCATTTATTATTTCAAAAT[C/G]
TTGTTTGAAGTAGTCCTAATTTGAAATTCAAATTCAAATTGTTGAAACAGAGTCATATAGAAAAATGTTCAAAACGAAAGTTGTAGATCTTGATAAGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 31.90% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 1.20% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 2.60% | 4.09% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 1.70% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406464503 | G -> C | LOC_Os04g11800.1 | upstream_gene_variant ; 691.0bp to feature; MODIFIER | silent_mutation | Average:15.234; most accessible tissue: Callus, score: 35.096 | N | N | N | N |
| vg0406464503 | G -> C | LOC_Os04g11790-LOC_Os04g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:15.234; most accessible tissue: Callus, score: 35.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406464503 | NA | 1.21E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | NA | 3.52E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | NA | 3.42E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 3.15E-29 | 1.31E-139 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 4.34E-14 | 5.06E-20 | mr1071 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 2.74E-18 | 3.12E-115 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 1.13E-09 | 1.01E-14 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 3.06E-14 | 3.61E-103 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | 4.66E-09 | 3.66E-15 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406464503 | NA | 2.59E-43 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/