Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406419424:

Variant ID: vg0406419424 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6419424
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCAAGATCTGCTTTGCCTCAGTTTCTCACCCTCAGAGCAACGGATAGGTCGAGAGGGCAAACGGCATAGTACTACAAGGGATCAAGACCCGTGTCTGT[G/A]
ACAGACTCATGTCACACGACAAGAAGTGGGTCGAAGAACTCCCCTCTGTCCTATGGGCCGTGCGTACCACACCGACAACGTCCAACAAGGAGACACCCTT

Reverse complement sequence

AAGGGTGTCTCCTTGTTGGACGTTGTCGGTGTGGTACGCACGGCCCATAGGACAGAGGGGAGTTCTTCGACCCACTTCTTGTCGTGTGACATGAGTCTGT[C/T]
ACAGACACGGGTCTTGATCCCTTGTAGTACTATGCCGTTTGCCCTCTCGACCTATCCGTTGCTCTGAGGGTGAGAAACTGAGGCAAAGCAGATCTTGACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	33.60%	2.96%	6.60%	NA
All Indica	2759	82.60%	2.70%	5.00%	9.64%	NA
All Japonica	1512	3.60%	96.00%	0.07%	0.33%	NA
Aus	269	98.50%	1.10%	0.00%	0.37%	NA
Indica I	595	98.70%	1.20%	0.00%	0.17%	NA
Indica II	465	74.40%	6.20%	15.91%	3.44%	NA
Indica III	913	74.50%	2.00%	4.38%	19.17%	NA
Indica Intermediate	786	84.90%	2.70%	3.05%	9.41%	NA
Temperate Japonica	767	4.80%	95.20%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.00%	0.00%	0.60%	NA
Japonica Intermediate	241	4.10%	94.60%	0.41%	0.83%	NA
VI/Aromatic	96	50.00%	16.70%	1.04%	32.29%	NA
Intermediate	90	44.40%	45.60%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406419424	G -> DEL	N	N	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0406419424	G -> A	LOC_Os04g11690.1	upstream_gene_variant ; 4692.0bp to feature; MODIFIER	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0406419424	G -> A	LOC_Os04g11700.1	downstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0406419424	G -> A	LOC_Os04g11710.1	downstream_gene_variant ; 142.0bp to feature; MODIFIER	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0406419424	G -> A	LOC_Os04g11720.1	downstream_gene_variant ; 1115.0bp to feature; MODIFIER	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N
vg0406419424	G -> A	LOC_Os04g11710-LOC_Os04g11720	intergenic_region ; MODIFIER	silent_mutation	Average:45.504; most accessible tissue: Minghui63 flag leaf, score: 71.116	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406419424	NA	8.51E-12	mr1233	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406419424	NA	1.33E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406419424	NA	3.39E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251