Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406373952:

Variant ID: vg0406373952 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6373952
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTGAATTACAGGAGGCTCTATTGTATCTTTTGTACATTAGAATAAGGTAGAGAGTGAGGGGAAGCTCTGGAGGAGTGCCCGGAAGTTTGGCATTCTTC[C/T]
GACTTCTACCTCGACAAGTGTAGCTTCCTAGGTGGAATTCTGGAGGAGTAGTGGAGCTGTCGGTACACTCTGCACCGGGTTAGGAGAATTTTCTTCTATT

Reverse complement sequence

AATAGAAGAAAATTCTCCTAACCCGGTGCAGAGTGTACCGACAGCTCCACTACTCCTCCAGAATTCCACCTAGGAAGCTACACTTGTCGAGGTAGAAGTC[G/A]
GAAGAATGCCAAACTTCCGGGCACTCCTCCAGAGCTTCCCCTCACTCTCTACCTTATTCTAATGTACAAAAGATACAATAGAGCCTCCTGTAATTCAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 22.50% 1.76% 1.40% NA
All Indica  2759 71.80% 25.10% 1.01% 2.14% NA
All Japonica  1512 95.00% 3.20% 1.52% 0.33% NA
Aus  269 3.00% 96.30% 0.37% 0.37% NA
Indica I  595 91.30% 8.70% 0.00% 0.00% NA
Indica II  465 46.20% 41.90% 1.51% 10.32% NA
Indica III  913 73.30% 24.90% 1.64% 0.22% NA
Indica Intermediate  786 70.40% 27.70% 0.76% 1.15% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 0.80% 3.37% 0.79% NA
Japonica Intermediate  241 92.90% 4.10% 2.49% 0.41% NA
VI/Aromatic  96 27.10% 43.80% 29.17% 0.00% NA
Intermediate  90 68.90% 26.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406373952 C -> DEL N N silent_mutation Average:40.972; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0406373952 C -> T LOC_Os04g11640.1 upstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:40.972; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg0406373952 C -> T LOC_Os04g11630.1 intron_variant ; MODIFIER silent_mutation Average:40.972; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406373952 NA 3.71E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.15E-06 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.73E-11 1.51E-16 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.17E-08 4.82E-13 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.36E-11 4.83E-17 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 8.04E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.33E-12 4.42E-18 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 4.95E-11 2.70E-16 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.81E-11 2.15E-16 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 3.10E-16 1.11E-24 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 7.55E-12 1.07E-16 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 4.04E-09 4.45E-13 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 2.66E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 6.24E-07 6.24E-07 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.17E-11 1.70E-23 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 8.08E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 6.23E-08 1.99E-10 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 5.53E-11 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 5.16E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 2.56E-15 1.21E-20 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.37E-12 3.28E-17 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 5.77E-15 7.72E-23 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 4.14E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.52E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 9.89E-16 4.43E-21 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 9.38E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 6.51E-10 5.75E-14 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 3.61E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 1.48E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.33E-08 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 4.83E-23 1.01E-35 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 3.08E-14 3.65E-18 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.30E-11 5.02E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 2.84E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 NA 1.14E-18 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 3.84E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 7.67E-27 8.53E-40 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406373952 1.85E-13 1.80E-22 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251