Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406362113:

Variant ID: vg0406362113 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6362113
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGCCTGGGCAGCGTTGACGAAGTCGAACTGCGGTCCTTGATTCCACAGCGAAACTCCCAAGCCCGGCTGAATCGGTGGCAACCAATTAGGCGCACCTT[G/A]
ACTTGTATTCCCCTCCGGGTGAGCCGATGGGGTTGTACTTGAAATGCAGTGGGGTTGGTTGAGTTGCTGAAGGAAAGCTTGGAGTTGCGCCTGCAGAGCC

Reverse complement sequence

GGCTCTGCAGGCGCAACTCCAAGCTTTCCTTCAGCAACTCAACCAACCCCACTGCATTTCAAGTACAACCCCATCGGCTCACCCGGAGGGGAATACAAGT[C/T]
AAGGTGCGCCTAATTGGTTGCCACCGATTCAGCCGGGCTTGGGAGTTTCGCTGTGGAATCAAGGACCGCAGTTCGACTTCGTCAACGCTGCCCAGGCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	11.60%	4.23%	0.00%	NA
All Indica	2759	82.50%	11.30%	6.20%	0.00%	NA
All Japonica	1512	95.20%	3.00%	1.85%	0.00%	NA
Aus	269	61.70%	38.30%	0.00%	0.00%	NA
Indica I	595	91.60%	7.70%	0.67%	0.00%	NA
Indica II	465	84.30%	3.20%	12.47%	0.00%	NA
Indica III	913	74.00%	16.00%	9.97%	0.00%	NA
Indica Intermediate	786	84.20%	13.50%	2.29%	0.00%	NA
Temperate Japonica	767	95.70%	4.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.40%	0.40%	4.17%	0.00%	NA
Japonica Intermediate	241	92.90%	4.10%	2.90%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406362113	G -> A	LOC_Os04g11620.1	N	stop_gained	Average:49.605; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg0406362113	G -> A	LOC_Os04g11620.1	N	nonsynonymous_codon ; Q333L	Average:49.605; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	possibly damaging	1.777	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406362113	9.36E-10	2.10E-14	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.41E-07	4.23E-12	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	6.83E-08	9.57E-13	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	4.29E-10	7.49E-16	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.06E-08	1.51E-13	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.71E-08	3.93E-13	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	5.41E-11	4.88E-18	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.37E-09	6.58E-14	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	5.78E-08	6.51E-12	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	3.47E-08	3.68E-18	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	NA	7.06E-08	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.65E-11	NA	mr1071_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.50E-16	2.71E-23	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.47E-10	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.11E-14	1.74E-20	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.02E-07	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	4.37E-12	2.35E-19	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.01E-11	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	6.57E-16	8.39E-23	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.29E-10	9.41E-15	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	4.08E-12	NA	mr1613_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.20E-24	3.07E-37	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.36E-08	NA	mr1619_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.51E-16	1.81E-21	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	1.77E-10	3.48E-15	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	5.80E-07	NA	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	4.81E-17	7.24E-28	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	2.41E-06	NA	mr1962_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406362113	8.25E-16	8.76E-25	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251