Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406361314:

Variant ID: vg0406361314 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6361314
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGCTTGAGCAGCGGCGACGGAGGCTTTGTCATACTCAACTTGTATAGCTTGCCGTCTCTTGGAATCCTCCTCGCCCCTTGCAAACCCGTCAATGATGC[G/A]
AAGTAGGTGCTCGAGCGTCTGAGGCTCCTTGTTGGCGATTTTTCTTGTGAGTTCGCCCTCGAGCAGACCGGCCGAAGCGGCGTTTATAACCGACGCCTTG

Reverse complement sequence

CAAGGCGTCGGTTATAAACGCCGCTTCGGCCGGTCTGCTCGAGGGCGAACTCACAAGAAAAATCGCCAACAAGGAGCCTCAGACGCTCGAGCACCTACTT[C/T]
GCATCATTGACGGGTTTGCAAGGGGCGAGGAGGATTCCAAGAGACGGCAAGCTATACAAGTTGAGTATGACAAAGCCTCCGTCGCCGCTGCTCAAGCTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	5.60%	4.19%	0.00%	NA
All Indica	2759	89.80%	5.40%	4.75%	0.00%	NA
All Japonica	1512	97.10%	2.20%	0.66%	0.00%	NA
Aus	269	64.70%	21.20%	14.13%	0.00%	NA
Indica I	595	92.80%	4.00%	3.19%	0.00%	NA
Indica II	465	97.80%	1.30%	0.86%	0.00%	NA
Indica III	913	84.90%	7.90%	7.23%	0.00%	NA
Indica Intermediate	786	88.50%	6.10%	5.34%	0.00%	NA
Temperate Japonica	767	95.70%	3.40%	0.91%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	96.30%	2.90%	0.83%	0.00%	NA
VI/Aromatic	96	64.60%	19.80%	15.62%	0.00%	NA
Intermediate	90	88.90%	6.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406361314	G -> A	LOC_Os04g11620.1	missense_variant ; p.Arg580Cys; MODERATE	nonsynonymous_codon ; R580C	Average:47.11; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	benign	0.72	TOLERATED	0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406361314	1.73E-11	1.51E-16	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.17E-08	4.82E-13	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.36E-11	4.83E-17	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.33E-12	4.42E-18	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	4.95E-11	2.70E-16	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	1.81E-11	2.15E-16	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.10E-16	1.11E-24	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	7.55E-12	1.07E-16	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	4.04E-09	4.45E-13	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	6.24E-07	6.24E-07	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	6.40E-06	NA	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.17E-11	1.70E-23	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	6.23E-08	1.99E-10	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.77E-08	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	2.56E-15	1.21E-20	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.71E-07	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	1.37E-12	3.28E-17	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	7.35E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	5.77E-15	7.72E-23	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.06E-08	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	9.89E-16	4.43E-21	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	6.51E-10	5.75E-14	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.12E-09	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	4.83E-23	1.01E-35	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.08E-14	3.65E-18	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	1.30E-11	5.02E-17	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	3.84E-06	NA	mr1888_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	5.10E-10	NA	mr1913_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	7.67E-27	8.53E-40	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406361314	1.85E-13	1.80E-22	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251