\
| Variant ID: vg0406361102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6361102 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )
CTGGCTGCTGATGGTTGCTCGCTTTCTCGGCATCGAACTCCTTGCGGAGGGCTTGCACTTCTACAACCGCCATCACAGCTTTGCCCGCACGGTCTGTTCT[G/A]
AACTTTCTCCAAGTTATGGGGGCTTGGCCTTGCCTCGGCGGCTGTCCTTGGATCGCCGGCTGAGACTGGCGAACGAAGAGGGGAGGTGGTTCGGCAACTT
AAGTTGCCGAACCACCTCCCCTCTTCGTTCGCCAGTCTCAGCCGGCGATCCAAGGACAGCCGCCGAGGCAAGGCCAAGCCCCCATAACTTGGAGAAAGTT[C/T]
AGAACAGACCGTGCGGGCAAAGCTGTGATGGCGGTTGTAGAAGTGCAAGCCCTCCGCAAGGAGTTCGATGCCGAGAAAGCGAGCAACCATCAGCAGCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 9.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 14.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.50% | 16.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406361102 | G -> A | LOC_Os04g11620.1 | synonymous_variant ; p.Phe650Phe; LOW | synonymous_codon | Average:42.546; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406361102 | NA | 3.63E-08 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | 4.03E-06 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | 2.27E-07 | 6.56E-08 | mr1062_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | 9.61E-06 | 1.98E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | NA | 7.26E-07 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | NA | 1.25E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | NA | 6.97E-07 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406361102 | NA | 3.67E-06 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |