\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406356417:

Variant ID: vg0406356417 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6356417
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCGTGTTGTGAACCTTCTATTCTTCAATTATTTTTTCGAAGTTAATAAAGATGTTTTTTATTTCCTTTTCGCTATTCTTTCGCATCGTCACATTTC[A/G]
TGCTTTTTTTAGGTCGGAACATGTCGGCCCCTTTGCGTATATTAGCGAAATAGGTGTACTGACTTTTCAGCTTTTCGTCGTTCGTTTTCGATCTGTAGCG

Reverse complement sequence

CGCTACAGATCGAAAACGAACGACGAAAAGCTGAAAAGTCAGTACACCTATTTCGCTAATATACGCAAAGGGGCCGACATGTTCCGACCTAAAAAAAGCA[T/C]
GAAATGTGACGATGCGAAAGAATAGCGAAAAGGAAATAAAAAACATCTTTATTAACTTCGAAAAAATAATTGAAGAATAGAAGGTTCACAACACGATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 34.40% 2.05% 0.80% NA
All Indica  2759 92.50% 4.60% 2.79% 0.07% NA
All Japonica  1512 4.00% 94.20% 0.53% 1.32% NA
Aus  269 84.80% 5.90% 3.72% 5.58% NA
Indica I  595 95.10% 3.00% 1.85% 0.00% NA
Indica II  465 77.00% 14.00% 9.03% 0.00% NA
Indica III  913 97.80% 0.90% 1.31% 0.00% NA
Indica Intermediate  786 93.50% 4.70% 1.53% 0.25% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 93.50% 0.99% 2.98% NA
Japonica Intermediate  241 4.10% 92.50% 1.24% 2.07% NA
VI/Aromatic  96 81.20% 17.70% 0.00% 1.04% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406356417 A -> DEL N N silent_mutation Average:24.584; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg0406356417 A -> G LOC_Os04g11600.1 upstream_gene_variant ; 4193.0bp to feature; MODIFIER silent_mutation Average:24.584; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg0406356417 A -> G LOC_Os04g11610.1 downstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:24.584; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg0406356417 A -> G LOC_Os04g11620.1 downstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:24.584; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg0406356417 A -> G LOC_Os04g11610-LOC_Os04g11620 intergenic_region ; MODIFIER silent_mutation Average:24.584; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406356417 2.70E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.56E-09 7.30E-15 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 5.66E-07 9.80E-12 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 2.07E-08 1.95E-14 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 3.66E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 2.38E-10 1.69E-16 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.00E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 2.13E-09 4.51E-15 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.17E-10 5.14E-15 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.35E-12 1.70E-21 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 9.23E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 5.46E-10 4.88E-15 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.53E-07 1.83E-11 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.74E-06 1.74E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 8.55E-11 3.69E-24 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.68E-16 5.76E-28 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 8.71E-06 1.83E-08 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.53E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 9.64E-13 1.16E-18 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.40E-11 4.50E-16 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.29E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.45E-13 7.96E-22 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.86E-08 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 6.17E-13 2.78E-19 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.32E-09 2.58E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 NA 4.39E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.22E-08 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 4.55E-17 8.34E-31 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 1.42E-12 1.13E-16 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 8.29E-11 2.75E-16 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 7.58E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 NA 3.14E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 6.15E-21 3.75E-34 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356417 8.96E-10 2.17E-19 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251