\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406356097:

Variant ID: vg0406356097 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6356097
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGATAAACGGTCGCAGCTACAAGGTTTTCAAGGTTGCTGACTGGCTGCGGGCGCACCCCGGGCGGACCTTAGAAGATTACGATCTTATTCATTCAAGA[C/A,T]
GTTTGGAGGATATGGCTCGCTTTTGGCGAAACCATCAGAAGACTAAACGTCAGGAAACGATCTTTCAGCGTCGTTACAGTTTAGTCTGTGTTTCGCCCCC

Reverse complement sequence

GGGGGCGAAACACAGACTAAACTGTAACGACGCTGAAAGATCGTTTCCTGACGTTTAGTCTTCTGATGGTTTCGCCAAAAGCGAGCCATATCCTCCAAAC[G/T,A]
TCTTGAATGAATAAGATCGTAATCTTCTAAGGTCCGCCCGGGGTGCGCCCGCAGCCAGTCAGCAACCTTGAAAACCTTGTAGCTGCGACCGTTTATCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 6.30% 2.98% 0.00% T: 0.76%
All Indica  2759 88.80% 5.90% 3.99% 0.00% T: 1.30%
All Japonica  1512 97.10% 2.70% 0.20% 0.00% NA
Aus  269 69.90% 23.40% 6.69% 0.00% NA
Indica I  595 92.90% 5.20% 1.68% 0.00% T: 0.17%
Indica II  465 97.20% 1.50% 1.08% 0.00% T: 0.22%
Indica III  913 82.10% 7.30% 7.01% 0.00% T: 3.50%
Indica Intermediate  786 88.50% 7.30% 3.94% 0.00% T: 0.25%
Temperate Japonica  767 95.70% 4.00% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 63.50% 29.20% 7.29% 0.00% NA
Intermediate  90 90.00% 6.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406356097 C -> A LOC_Os04g11600.1 upstream_gene_variant ; 3873.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> A LOC_Os04g11610.1 downstream_gene_variant ; 514.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> A LOC_Os04g11620.1 downstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> A LOC_Os04g11610-LOC_Os04g11620 intergenic_region ; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> T LOC_Os04g11600.1 upstream_gene_variant ; 3873.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> T LOC_Os04g11610.1 downstream_gene_variant ; 514.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> T LOC_Os04g11620.1 downstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0406356097 C -> T LOC_Os04g11610-LOC_Os04g11620 intergenic_region ; MODIFIER silent_mutation Average:20.098; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406356097 3.22E-07 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.21E-10 4.84E-15 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.72E-08 8.28E-13 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 5.07E-11 2.66E-16 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 9.12E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.61E-11 4.86E-16 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 7.02E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.28E-10 5.13E-15 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.99E-10 1.22E-14 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 NA 5.98E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 9.07E-14 1.73E-20 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 7.05E-11 3.49E-15 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 6.25E-08 2.05E-11 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.14E-06 2.14E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 7.58E-10 1.34E-19 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 5.84E-08 2.70E-10 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.06E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 5.26E-14 5.78E-19 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 3.73E-08 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 6.76E-12 2.32E-16 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.31E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.15E-14 4.89E-22 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 9.48E-09 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 3.45E-14 7.15E-19 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 5.22E-09 2.95E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.34E-10 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 9.47E-21 5.58E-31 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 7.54E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.04E-13 1.84E-17 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 6.13E-12 3.22E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 7.14E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 2.26E-08 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 1.44E-23 4.25E-34 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 8.16E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406356097 3.79E-13 1.06E-21 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251