\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406345405:

Variant ID: vg0406345405 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 6345405
Reference Allele: AGAlternative Allele: A,TG
Primary Allele: AGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGTAGTAGACGCATAAGTTAGTTCCCTGGTCCTGCTTTGCACACTACATGAGAAACGATGAGAGATTTAATATAATCTTTATATTTAACTGTAATTAG[AG/A,TG]
ATTTAATTCAATACAATTTTGGATCATGCATATACTCACTGGAAAATGAAACCTCCGTCCAAGTTTTTCTTTCCAAGTCCCGCGGACCAATTGACGGAAC

Reverse complement sequence

GTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCAGTGAGTATATGCATGATCCAAAATTGTATTGAATTAAAT[CT/T,CA]
CTAATTACAGTTAAATATAAAGATTATATTAAATCTCTCATCGTTTCTCATGTAGTGTGCAAAGCAGGACCAGGGAACTAACTTATGCGTCTACTACGTA

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 10.40% 3.22% 0.55% A: 0.68%
All Indica  2759 82.90% 11.20% 4.86% 0.00% A: 1.09%
All Japonica  1512 95.20% 2.80% 0.26% 1.72% NA
Aus  269 60.60% 35.30% 3.72% 0.00% A: 0.37%
Indica I  595 91.30% 8.20% 0.34% 0.00% A: 0.17%
Indica II  465 75.30% 3.00% 18.71% 0.00% A: 3.01%
Indica III  913 82.30% 15.40% 1.97% 0.00% A: 0.33%
Indica Intermediate  786 81.80% 13.20% 3.44% 0.00% A: 1.53%
Temperate Japonica  767 95.80% 4.20% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 0.40% 0.60% 3.97% NA
Japonica Intermediate  241 93.80% 3.30% 0.41% 2.49% NA
VI/Aromatic  96 61.50% 36.50% 2.08% 0.00% NA
Intermediate  90 85.60% 11.10% 2.22% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406345405 AG -> DEL N N silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> A LOC_Os04g11570.1 downstream_gene_variant ; 4244.0bp to feature; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> A LOC_Os04g11590.1 downstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> A LOC_Os04g11580.1 intron_variant ; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> TG LOC_Os04g11570.1 downstream_gene_variant ; 4243.0bp to feature; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> TG LOC_Os04g11590.1 downstream_gene_variant ; 1150.0bp to feature; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0406345405 AG -> TG LOC_Os04g11580.1 intron_variant ; MODIFIER silent_mutation Average:35.385; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406345405 7.40E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.73E-11 1.51E-16 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 7.85E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 2.17E-08 4.82E-13 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 2.36E-11 4.83E-17 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.04E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 2.33E-12 4.42E-18 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 3.92E-07 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 4.95E-11 2.70E-16 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.13E-07 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.81E-11 2.15E-16 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 3.18E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 3.10E-16 1.11E-24 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 9.37E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 7.55E-12 1.07E-16 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 4.04E-09 4.45E-13 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 6.24E-07 6.24E-07 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 2.17E-11 1.70E-23 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 6.23E-08 1.99E-10 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.95E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 2.56E-15 1.21E-20 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.05E-07 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.37E-12 3.28E-17 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.11E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 5.77E-15 7.72E-23 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 5.21E-09 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 9.89E-16 4.43E-21 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 6.51E-10 5.75E-14 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 4.09E-08 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 4.83E-23 1.01E-35 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 6.85E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 3.08E-14 3.65E-18 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.30E-11 5.02E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 3.84E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 6.29E-07 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 7.67E-27 8.53E-40 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345405 1.85E-13 1.80E-22 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251