Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406325095:

Variant ID: vg0406325095 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6325095
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTAGATTGCTAGCTAAATGTGCGATGTTATTGTTTGATGTTTCCGACAGGAATTATCGGCTTCCGATCGATACCGACACATTTCCGATTGAATAATTC[C/T]
ATTTTCGATTTAGATATTTCCGATATCGTTTCCGCTACCGGCTTACCGTTATCGATTATGTTTCCGAAAAATAATATGGTTGCGGTAATGGTTTAGGGTG

Reverse complement sequence

CACCCTAAACCATTACCGCAACCATATTATTTTTCGGAAACATAATCGATAACGGTAAGCCGGTAGCGGAAACGATATCGGAAATATCTAAATCGAAAAT[G/A]
GAATTATTCAATCGGAAATGTGTCGGTATCGATCGGAAGCCGATAATTCCTGTCGGAAACATCAAACAATAACATCGCACATTTAGCTAGCAATCTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	20.40%	0.63%	12.80%	NA
All Indica	2759	49.40%	34.50%	0.80%	15.30%	NA
All Japonica	1512	97.80%	0.00%	0.00%	2.18%	NA
Aus	269	46.50%	0.70%	2.60%	50.19%	NA
Indica I	595	26.90%	72.10%	0.00%	1.01%	NA
Indica II	465	31.40%	16.10%	2.58%	49.89%	NA
Indica III	913	68.80%	22.00%	0.66%	8.54%	NA
Indica Intermediate	786	54.70%	31.30%	0.51%	13.49%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.20%	0.00%	0.00%	4.76%	NA
Japonica Intermediate	241	96.70%	0.00%	0.00%	3.32%	NA
VI/Aromatic	96	92.70%	2.10%	0.00%	5.21%	NA
Intermediate	90	78.90%	8.90%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406325095	C -> DEL	N	N	silent_mutation	Average:41.773; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0406325095	C -> T	LOC_Os04g11550.1	upstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:41.773; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0406325095	C -> T	LOC_Os04g11540.1	downstream_gene_variant ; 1041.0bp to feature; MODIFIER	silent_mutation	Average:41.773; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0406325095	C -> T	LOC_Os04g11540-LOC_Os04g11550	intergenic_region ; MODIFIER	silent_mutation	Average:41.773; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406325095	4.99E-06	NA	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406325095	4.79E-06	5.00E-12	mr1846	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251