Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406289584:

Variant ID: vg0406289584 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6289584
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACCTGATTAATAGGGCCTGCACTAGAGATAAGTGGATCTCCCAGGCCTTCGTGTGTCGTGATGAATTTCATGTTAACACCTCTATGTGGCGCTGAAC[G/A]
TTGTACGTGAGGTGGAACAGTGAGGCGTCCCCTCAAGCGGAACAATACAGTCGTCCCCTAACAAATCATAAATAAATGTGAGGTAGAACATTACAGTCAT

Reverse complement sequence

ATGACTGTAATGTTCTACCTCACATTTATTTATGATTTGTTAGGGGACGACTGTATTGTTCCGCTTGAGGGGACGCCTCACTGTTCCACCTCACGTACAA[C/T]
GTTCAGCGCCACATAGAGGTGTTAACATGAAATTCATCACGACACACGAAGGCCTGGGAGATCCACTTATCTCTAGTGCAGGCCCTATTAATCAGGTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 11.70% 0.40% 12.29% NA
All Indica  2759 72.90% 11.50% 0.54% 15.15% NA
All Japonica  1512 96.70% 3.00% 0.00% 0.33% NA
Aus  269 8.90% 37.50% 0.74% 52.79% NA
Indica I  595 90.90% 7.90% 0.17% 1.01% NA
Indica II  465 47.30% 3.20% 2.15% 47.31% NA
Indica III  913 75.00% 15.80% 0.22% 8.98% NA
Indica Intermediate  786 71.80% 14.00% 0.25% 13.99% NA
Temperate Japonica  767 95.70% 4.20% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 94.60% 4.60% 0.00% 0.83% NA
VI/Aromatic  96 18.80% 76.00% 0.00% 5.21% NA
Intermediate  90 65.60% 20.00% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406289584 G -> DEL N N silent_mutation Average:56.115; most accessible tissue: Zhenshan97 young leaf, score: 78.644 N N N N
vg0406289584 G -> A LOC_Os04g11490.1 upstream_gene_variant ; 4246.0bp to feature; MODIFIER silent_mutation Average:56.115; most accessible tissue: Zhenshan97 young leaf, score: 78.644 N N N N
vg0406289584 G -> A LOC_Os04g11500.1 upstream_gene_variant ; 975.0bp to feature; MODIFIER silent_mutation Average:56.115; most accessible tissue: Zhenshan97 young leaf, score: 78.644 N N N N
vg0406289584 G -> A LOC_Os04g11510.1 downstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:56.115; most accessible tissue: Zhenshan97 young leaf, score: 78.644 N N N N
vg0406289584 G -> A LOC_Os04g11500-LOC_Os04g11510 intergenic_region ; MODIFIER silent_mutation Average:56.115; most accessible tissue: Zhenshan97 young leaf, score: 78.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406289584 4.14E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 2.04E-12 4.15E-18 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 7.39E-09 9.32E-14 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.04E-12 1.12E-18 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.30E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 8.10E-14 1.51E-20 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.25E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.29E-12 2.53E-18 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 9.47E-07 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.17E-13 5.35E-19 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 7.27E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.78E-20 4.08E-30 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 8.49E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.68E-13 1.04E-18 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.28E-10 1.01E-14 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 2.68E-06 2.68E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 2.04E-10 9.16E-23 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.81E-09 6.00E-12 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.17E-10 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 5.98E-17 1.38E-23 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 2.55E-09 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.48E-13 3.11E-19 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.83E-09 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.00E-16 1.67E-25 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 8.06E-12 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.59E-17 1.07E-24 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.79E-12 1.91E-16 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.12E-11 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.15E-25 2.64E-41 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.07E-07 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 3.60E-14 9.72E-19 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.16E-10 8.47E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 2.84E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.61E-06 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.05E-20 1.88E-33 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 4.52E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406289584 1.14E-14 1.12E-24 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251