| Variant ID: vg0406288626 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6288626 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCGGTCATTGATGGACCAGCCGAGATCGGCACCGTGGTGAAAACTGGGAAGACGATTTCACCGACTTGAGTCCACACCAGCATTGTTGAAGGTTAAACT[C/T]
CTTGGTTGATGCTGGTGTTGACGTTATTGTTGATGAGGCTTGATGGCATAGTAGTAGAACCTTGAGCACCAAGTCCCCGTACCTAGCGCGCAACTGTCGA
TCGACAGTTGCGCGCTAGGTACGGGGACTTGGTGCTCAAGGTTCTACTACTATGCCATCAAGCCTCATCAACAATAACGTCAACACCAGCATCAACCAAG[G/A]
AGTTTAACCTTCAACAATGCTGGTGTGGACTCAAGTCGGTGAAATCGTCTTCCCAGTTTTCACCACGGTGCCGATCTCGGCTGGTCCATCAATGACCGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 2.40% | 2.29% | 10.18% | NA |
| All Indica | 2759 | 85.90% | 0.00% | 2.14% | 11.92% | NA |
| All Japonica | 1512 | 88.90% | 7.30% | 2.45% | 1.39% | NA |
| Aus | 269 | 52.40% | 0.00% | 3.72% | 43.87% | NA |
| Indica I | 595 | 99.00% | 0.00% | 0.34% | 0.67% | NA |
| Indica II | 465 | 55.90% | 0.00% | 5.59% | 38.49% | NA |
| Indica III | 913 | 91.90% | 0.00% | 1.86% | 6.24% | NA |
| Indica Intermediate | 786 | 86.90% | 0.00% | 1.78% | 11.32% | NA |
| Temperate Japonica | 767 | 83.20% | 12.60% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 2.00% | 0.60% | 3.17% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 86.70% | 2.20% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406288626 | C -> DEL | N | N | silent_mutation | Average:53.123; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0406288626 | C -> T | LOC_Os04g11490.1 | upstream_gene_variant ; 3288.0bp to feature; MODIFIER | silent_mutation | Average:53.123; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0406288626 | C -> T | LOC_Os04g11500.1 | upstream_gene_variant ; 17.0bp to feature; MODIFIER | silent_mutation | Average:53.123; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0406288626 | C -> T | LOC_Os04g11510.1 | downstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:53.123; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0406288626 | C -> T | LOC_Os04g11500-LOC_Os04g11510 | intergenic_region ; MODIFIER | silent_mutation | Average:53.123; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406288626 | 2.30E-15 | 1.53E-19 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406288626 | 4.83E-10 | 4.83E-10 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406288626 | 1.59E-06 | 3.04E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406288626 | NA | 2.27E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |