Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406285046:

Variant ID: vg0406285046 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6285046
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, G: 0.33, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCGGAGATCATCAATCAATGAGTCGCTTGTCTTGGTCTTGACAACAATGTCATCGACGTAGGCCTCGACATTGTTCCCAGGCTGATCGTTAAGTGCC[G/C]
CTTGGACCGTGCGTTGGAAAGTATTTCCTGCGGTTATCAGTCCAAACAGCATCTTAACGTAACAGAATACACTGAACGGCATGATGAATGCTGTCTTCTC

Reverse complement sequence

GAGAAGACAGCATTCATCATGCCGTTCAGTGTATTCTGTTACGTTAAGATGCTGTTTGGACTGATAACCGCAGGAAATACTTTCCAACGCACGGTCCAAG[C/G]
GGCACTTAACGATCAGCCTGGGAACAATGTCGAGGCCTACGTCGATGACATTGTTGTCAAGACCAAGACAAGCGACTCATTGATTGATGATCTCCGGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 35.60% 9.42% 1.21% NA
All Indica  2759 81.60% 4.50% 12.65% 1.27% NA
All Japonica  1512 3.60% 94.40% 0.79% 1.19% NA
Aus  269 43.50% 29.00% 26.77% 0.74% NA
Indica I  595 98.50% 0.70% 0.84% 0.00% NA
Indica II  465 41.30% 12.70% 39.57% 6.45% NA
Indica III  913 90.00% 2.00% 7.89% 0.11% NA
Indica Intermediate  786 82.70% 5.60% 11.20% 0.51% NA
Temperate Japonica  767 4.60% 95.30% 0.13% 0.00% NA
Tropical Japonica  504 1.60% 93.80% 1.59% 2.98% NA
Japonica Intermediate  241 4.60% 92.90% 1.24% 1.24% NA
VI/Aromatic  96 82.30% 14.60% 3.12% 0.00% NA
Intermediate  90 44.40% 43.30% 10.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406285046 G -> C LOC_Os04g11490.1 missense_variant ; p.Ala98Gly; MODERATE nonsynonymous_codon ; A98G Average:56.496; most accessible tissue: Minghui63 young leaf, score: 75.937 benign -1.311 TOLERATED 1.00
vg0406285046 G -> DEL LOC_Os04g11490.1 N frameshift_variant Average:56.496; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406285046 NA 1.02E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 5.27E-11 8.90E-107 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.04E-12 4.15E-18 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.53E-07 7.17E-92 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 7.39E-09 9.32E-14 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 5.87E-09 7.77E-88 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.04E-12 1.12E-18 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.26E-12 1.13E-107 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 8.10E-14 1.51E-20 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 2.83E-18 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.15E-18 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.68E-11 1.07E-110 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.29E-12 2.53E-18 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.14E-12 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.79E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.96E-09 1.54E-98 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.17E-13 5.35E-19 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.63E-17 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.16E-14 mr1553 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.24E-08 2.88E-90 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.78E-20 4.08E-30 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.66E-11 3.69E-107 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.68E-13 1.04E-18 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.10E-71 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.28E-10 1.01E-14 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.46E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 6.88E-18 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 3.72E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.18E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 2.38E-16 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.68E-06 2.68E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.04E-10 9.16E-23 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.74E-17 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.13E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.81E-09 6.00E-12 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 8.16E-17 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.82E-20 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.85E-15 5.68E-127 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 5.98E-17 1.38E-23 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.05E-11 1.13E-120 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.48E-13 3.11E-19 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.15E-14 2.65E-119 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.00E-16 1.67E-25 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 4.21E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.21E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.14E-16 4.02E-132 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.59E-17 1.07E-24 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 8.73E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.47E-08 2.54E-73 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 4.79E-12 1.91E-16 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.42E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.60E-12 1.49E-139 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.15E-25 2.64E-41 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 2.19E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.61E-10 1.64E-111 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.60E-14 9.72E-19 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 3.70E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 2.11E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 1.99E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 2.37E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.39E-07 1.70E-86 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.16E-10 8.47E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 NA 5.44E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 2.84E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 5.77E-07 8.45E-37 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.05E-20 1.88E-33 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 3.56E-07 3.09E-122 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406285046 1.14E-14 1.12E-24 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251