\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406258553:

Variant ID: vg0406258553 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6258553
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCCTTTGGTACCGTTTTCTTTGCTGTGCTATGATCGAATTTTCTCCACAGAGAAACCCGTTAACAAATTTCTCACTTCGATTGGAAGCACATATCATC[G/A]
GTTTTCCTACTATACATAACACTTTCATCACATTTTGAGCTAACGGTGTTAGATTAAAGTAGAAAAATTTATCCTGTAATAACTAATTTTGAGTTAACGG

Reverse complement sequence

CCGTTAACTCAAAATTAGTTATTACAGGATAAATTTTTCTACTTTAATCTAACACCGTTAGCTCAAAATGTGATGAAAGTGTTATGTATAGTAGGAAAAC[C/T]
GATGATATGTGCTTCCAATCGAAGTGAGAAATTTGTTAACGGGTTTCTCTGTGGAGAAAATTCGATCATAGCACAGCAAAGAAAACGGTACCAAAGGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 29.50% 0.11% 2.07% NA
All Indica  2759 53.00% 43.30% 0.18% 3.48% NA
All Japonica  1512 99.20% 0.70% 0.00% 0.07% NA
Aus  269 40.90% 59.10% 0.00% 0.00% NA
Indica I  595 81.70% 18.30% 0.00% 0.00% NA
Indica II  465 25.60% 56.10% 0.43% 17.85% NA
Indica III  913 51.80% 48.00% 0.00% 0.22% NA
Indica Intermediate  786 48.90% 49.40% 0.38% 1.40% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406258553 G -> DEL N N silent_mutation Average:68.373; most accessible tissue: Callus, score: 94.082 N N N N
vg0406258553 G -> A LOC_Os04g11440.1 upstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:68.373; most accessible tissue: Callus, score: 94.082 N N N N
vg0406258553 G -> A LOC_Os04g11450.1 downstream_gene_variant ; 4030.0bp to feature; MODIFIER silent_mutation Average:68.373; most accessible tissue: Callus, score: 94.082 N N N N
vg0406258553 G -> A LOC_Os04g11440-LOC_Os04g11450 intergenic_region ; MODIFIER silent_mutation Average:68.373; most accessible tissue: Callus, score: 94.082 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406258553 NA 3.17E-15 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 1.17E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 6.25E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 2.75E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 2.94E-11 mr1608_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 6.09E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 2.02E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 4.80E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 2.57E-19 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 2.30E-12 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553 NA 1.07E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251