Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406258553:

Variant ID: vg0406258553 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6258553
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCCTTTGGTACCGTTTTCTTTGCTGTGCTATGATCGAATTTTCTCCACAGAGAAACCCGTTAACAAATTTCTCACTTCGATTGGAAGCACATATCATC[G/A]
GTTTTCCTACTATACATAACACTTTCATCACATTTTGAGCTAACGGTGTTAGATTAAAGTAGAAAAATTTATCCTGTAATAACTAATTTTGAGTTAACGG

Reverse complement sequence

CCGTTAACTCAAAATTAGTTATTACAGGATAAATTTTTCTACTTTAATCTAACACCGTTAGCTCAAAATGTGATGAAAGTGTTATGTATAGTAGGAAAAC[C/T]
GATGATATGTGCTTCCAATCGAAGTGAGAAATTTGTTAACGGGTTTCTCTGTGGAGAAAATTCGATCATAGCACAGCAAAGAAAACGGTACCAAAGGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.30%	29.50%	0.11%	2.07%	NA
All Indica	2759	53.00%	43.30%	0.18%	3.48%	NA
All Japonica	1512	99.20%	0.70%	0.00%	0.07%	NA
Aus	269	40.90%	59.10%	0.00%	0.00%	NA
Indica I	595	81.70%	18.30%	0.00%	0.00%	NA
Indica II	465	25.60%	56.10%	0.43%	17.85%	NA
Indica III	913	51.80%	48.00%	0.00%	0.22%	NA
Indica Intermediate	786	48.90%	49.40%	0.38%	1.40%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406258553	G -> DEL	N	N	silent_mutation	Average:68.373; most accessible tissue: Callus, score: 94.082	N	N	N	N
vg0406258553	G -> A	LOC_Os04g11440.1	upstream_gene_variant ; 202.0bp to feature; MODIFIER	silent_mutation	Average:68.373; most accessible tissue: Callus, score: 94.082	N	N	N	N
vg0406258553	G -> A	LOC_Os04g11450.1	downstream_gene_variant ; 4030.0bp to feature; MODIFIER	silent_mutation	Average:68.373; most accessible tissue: Callus, score: 94.082	N	N	N	N
vg0406258553	G -> A	LOC_Os04g11440-LOC_Os04g11450	intergenic_region ; MODIFIER	silent_mutation	Average:68.373; most accessible tissue: Callus, score: 94.082	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406258553	NA	3.17E-15	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	1.17E-09	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	6.25E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	2.75E-09	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	2.94E-11	mr1608_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	6.09E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	2.02E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	4.80E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	2.57E-19	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	2.30E-12	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406258553	NA	1.07E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251