\
| Variant ID: vg0406258553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6258553 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGCCTTTGGTACCGTTTTCTTTGCTGTGCTATGATCGAATTTTCTCCACAGAGAAACCCGTTAACAAATTTCTCACTTCGATTGGAAGCACATATCATC[G/A]
GTTTTCCTACTATACATAACACTTTCATCACATTTTGAGCTAACGGTGTTAGATTAAAGTAGAAAAATTTATCCTGTAATAACTAATTTTGAGTTAACGG
CCGTTAACTCAAAATTAGTTATTACAGGATAAATTTTTCTACTTTAATCTAACACCGTTAGCTCAAAATGTGATGAAAGTGTTATGTATAGTAGGAAAAC[C/T]
GATGATATGTGCTTCCAATCGAAGTGAGAAATTTGTTAACGGGTTTCTCTGTGGAGAAAATTCGATCATAGCACAGCAAAGAAAACGGTACCAAAGGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 29.50% | 0.11% | 2.07% | NA |
| All Indica | 2759 | 53.00% | 43.30% | 0.18% | 3.48% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 25.60% | 56.10% | 0.43% | 17.85% | NA |
| Indica III | 913 | 51.80% | 48.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 48.90% | 49.40% | 0.38% | 1.40% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406258553 | G -> DEL | N | N | silent_mutation | Average:68.373; most accessible tissue: Callus, score: 94.082 | N | N | N | N |
| vg0406258553 | G -> A | LOC_Os04g11440.1 | upstream_gene_variant ; 202.0bp to feature; MODIFIER | silent_mutation | Average:68.373; most accessible tissue: Callus, score: 94.082 | N | N | N | N |
| vg0406258553 | G -> A | LOC_Os04g11450.1 | downstream_gene_variant ; 4030.0bp to feature; MODIFIER | silent_mutation | Average:68.373; most accessible tissue: Callus, score: 94.082 | N | N | N | N |
| vg0406258553 | G -> A | LOC_Os04g11440-LOC_Os04g11450 | intergenic_region ; MODIFIER | silent_mutation | Average:68.373; most accessible tissue: Callus, score: 94.082 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406258553 | NA | 3.17E-15 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 1.17E-09 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 6.25E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 2.75E-09 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 2.94E-11 | mr1608_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 6.09E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 2.02E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 4.80E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 2.57E-19 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 2.30E-12 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406258553 | NA | 1.07E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |