Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406233178:

Variant ID: vg0406233178 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6233178
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATGTTACAATACATATATATGCATAATATATAAGCATATATATATATGTGCATATATATATATATATGCATATGTGTATATGTATAAATCATATATT[A/G]
CACACACATATGTATAATTTAAAGCACTTAACATTTTATGTGCATATATGTTACCAAAATATATATTAACACTAAAGTAAAGTAAATGTGTACATATATA

Reverse complement sequence

TATATATGTACACATTTACTTTACTTTAGTGTTAATATATATTTTGGTAACATATATGCACATAAAATGTTAAGTGCTTTAAATTATACATATGTGTGTG[T/C]
AATATATGATTTATACATATACACATATGCATATATATATATATATGCACATATATATATATGCTTATATATTATGCATATATATGTATTGTAACATATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	0.40%	7.02%	3.72%	NA
All Indica	2759	97.10%	0.70%	2.14%	0.14%	NA
All Japonica	1512	71.80%	0.10%	17.66%	10.45%	NA
Aus	269	97.40%	0.00%	0.37%	2.23%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.30%	0.20%	1.08%	0.43%	NA
Indica III	913	95.60%	1.20%	3.07%	0.11%	NA
Indica Intermediate	786	96.10%	0.80%	3.05%	0.13%	NA
Temperate Japonica	767	61.50%	0.00%	25.03%	13.43%	NA
Tropical Japonica	504	82.10%	0.20%	9.72%	7.94%	NA
Japonica Intermediate	241	83.00%	0.00%	10.79%	6.22%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	88.90%	0.00%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406233178	A -> DEL	N	N	silent_mutation	Average:12.42; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0406233178	A -> G	LOC_Os04g11400.1	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:12.42; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0406233178	A -> G	LOC_Os04g11400.2	upstream_gene_variant ; 699.0bp to feature; MODIFIER	silent_mutation	Average:12.42; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0406233178	A -> G	LOC_Os04g11410.1	downstream_gene_variant ; 159.0bp to feature; MODIFIER	silent_mutation	Average:12.42; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0406233178	A -> G	LOC_Os04g11400-LOC_Os04g11410	intergenic_region ; MODIFIER	silent_mutation	Average:12.42; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406233178	3.42E-06	3.42E-06	mr1379	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406233178	NA	5.42E-07	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406233178	NA	9.65E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251