\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406221879:

Variant ID: vg0406221879 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6221879
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAATTTGAAAACGGTAGCATGCGGCAGCCGGGATGGTGGCAATGGCAGCGGTGGCTCGGGTTGCCAATAGAGATGATGCCTCAGTGGTGGATTGGAGG[G/A]
GCGAAGCGGCGGCTAGGGCGCAGGGTGGAGCGGCGAAGCCATCTATGGTGGTGGCTATAGGGTGTCGGCGGTGGAGCTTGGGCTCGTGGAGGAGTCGGGG

Reverse complement sequence

CCCCGACTCCTCCACGAGCCCAAGCTCCACCGCCGACACCCTATAGCCACCACCATAGATGGCTTCGCCGCTCCACCCTGCGCCCTAGCCGCCGCTTCGC[C/T]
CCTCCAATCCACCACTGAGGCATCATCTCTATTGGCAACCCGAGCCACCGCTGCCATTGCCACCATCCCGGCTGCCGCATGCTACCGTTTTCAAATTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 7.60% 0.47% 0.00% NA
All Indica  2759 87.90% 11.30% 0.80% 0.00% NA
All Japonica  1512 97.70% 2.30% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 93.40% 6.40% 0.17% 0.00% NA
Indica II  465 86.70% 10.10% 3.23% 0.00% NA
Indica III  913 90.30% 9.50% 0.22% 0.00% NA
Indica Intermediate  786 81.80% 17.70% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406221879 G -> A LOC_Os04g11390.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N
vg0406221879 G -> A LOC_Os04g11390.2 downstream_gene_variant ; 3213.0bp to feature; MODIFIER silent_mutation Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N
vg0406221879 G -> A LOC_Os04g11370-LOC_Os04g11390 intergenic_region ; MODIFIER silent_mutation Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406221879 7.97E-06 7.42E-08 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 7.65E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 1.66E-08 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 3.43E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 1.38E-08 mr1515 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 4.96E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 NA 2.38E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 3.22E-06 3.16E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406221879 5.10E-06 5.10E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251