\
| Variant ID: vg0406221879 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6221879 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )
TCGAATTTGAAAACGGTAGCATGCGGCAGCCGGGATGGTGGCAATGGCAGCGGTGGCTCGGGTTGCCAATAGAGATGATGCCTCAGTGGTGGATTGGAGG[G/A]
GCGAAGCGGCGGCTAGGGCGCAGGGTGGAGCGGCGAAGCCATCTATGGTGGTGGCTATAGGGTGTCGGCGGTGGAGCTTGGGCTCGTGGAGGAGTCGGGG
CCCCGACTCCTCCACGAGCCCAAGCTCCACCGCCGACACCCTATAGCCACCACCATAGATGGCTTCGCCGCTCCACCCTGCGCCCTAGCCGCCGCTTCGC[C/T]
CCTCCAATCCACCACTGAGGCATCATCTCTATTGGCAACCCGAGCCACCGCTGCCATTGCCACCATCCCGGCTGCCGCATGCTACCGTTTTCAAATTCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 7.60% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 87.90% | 11.30% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 6.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 86.70% | 10.10% | 3.23% | 0.00% | NA |
| Indica III | 913 | 90.30% | 9.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.80% | 17.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406221879 | G -> A | LOC_Os04g11390.1 | downstream_gene_variant ; 3259.0bp to feature; MODIFIER | silent_mutation | Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 | N | N | N | N |
| vg0406221879 | G -> A | LOC_Os04g11390.2 | downstream_gene_variant ; 3213.0bp to feature; MODIFIER | silent_mutation | Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 | N | N | N | N |
| vg0406221879 | G -> A | LOC_Os04g11370-LOC_Os04g11390 | intergenic_region ; MODIFIER | silent_mutation | Average:68.391; most accessible tissue: Zhenshan97 young leaf, score: 90.363 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406221879 | 7.97E-06 | 7.42E-08 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 7.65E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 1.66E-08 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 3.43E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 1.38E-08 | mr1515 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 4.96E-07 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | NA | 2.38E-07 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | 3.22E-06 | 3.16E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406221879 | 5.10E-06 | 5.10E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |