Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406209150:

Variant ID: vg0406209150 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6209150
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAGTAGTTATGTAATGGTGGTATGTAAGGTGATGTGTGATCATATCGCAAATTGACGAACAATTGTACTCAAAATTTTGCATATTAGTTTGTACTAAT[T/A]
TTTATGTGCAATTACCATTTGTAGGGTAACATTTACAGTTTTTTATATTTTAAAAGTTTTTTTAAAAGAGGTTTAAAAATTTAGTAGCATTTTTTTATGT

Reverse complement sequence

ACATAAAAAAATGCTACTAAATTTTTAAACCTCTTTTAAAAAAACTTTTAAAATATAAAAAACTGTAAATGTTACCCTACAAATGGTAATTGCACATAAA[A/T]
ATTAGTACAAACTAATATGCAAAATTTTGAGTACAATTGTTCGTCAATTTGCGATATGATCACACATCACCTTACATACCACCATTACATAACTACTAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 9.10% 2.52% 0.02% NA
All Indica  2759 86.60% 10.10% 3.23% 0.04% NA
All Japonica  1512 97.20% 2.60% 0.13% 0.00% NA
Aus  269 64.30% 26.40% 9.29% 0.00% NA
Indica I  595 83.20% 12.30% 4.54% 0.00% NA
Indica II  465 95.30% 3.40% 1.29% 0.00% NA
Indica III  913 85.80% 11.00% 3.29% 0.00% NA
Indica Intermediate  786 85.00% 11.60% 3.31% 0.13% NA
Temperate Japonica  767 96.00% 3.90% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 67.70% 31.20% 1.04% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406209150 T -> DEL N N silent_mutation Average:16.905; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0406209150 T -> A LOC_Os04g11370.1 upstream_gene_variant ; 1893.0bp to feature; MODIFIER silent_mutation Average:16.905; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0406209150 T -> A LOC_Os04g11350-LOC_Os04g11370 intergenic_region ; MODIFIER silent_mutation Average:16.905; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406209150 2.98E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.61E-10 7.72E-15 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.92E-08 1.05E-12 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 6.33E-11 3.92E-16 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 3.78E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 3.60E-11 8.52E-16 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 4.36E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.95E-10 7.93E-15 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 3.63E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.71E-10 1.99E-14 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 6.72E-06 NA mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 NA 5.83E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.57E-13 4.46E-20 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 6.65E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 9.59E-11 5.60E-15 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 8.25E-08 3.09E-11 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.51E-06 2.51E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.06E-09 3.25E-19 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 6.53E-08 3.22E-10 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.10E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 7.90E-14 1.04E-18 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 5.17E-08 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 8.93E-12 3.48E-16 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 4.27E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.52E-14 8.42E-22 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.07E-08 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 5.34E-14 1.37E-18 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 6.73E-09 4.05E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 2.80E-10 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.82E-20 2.14E-30 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 9.56E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 1.41E-13 2.77E-17 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 7.00E-12 4.23E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 8.03E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 3.47E-23 2.06E-33 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 3.23E-07 NA mr1962_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406209150 4.77E-13 1.80E-21 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251