\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406165696:

Variant ID: vg0406165696 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6165696
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.20, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GGAATGCTGCGGGAATAGAGTAAGAATCAGCTGGAGTCCAAATCGGCTATGACCAGAATCGGCTGAATCCGAATCATACATTCGAATGCGAGCTTTGGAC[C/A]
TGTACTAGAGTTAAGCAGATCTCCCAGGCCTCGTGTTTTCTGTGAACAGGCGGCGAAGGGAGGTCCGGTTAAAAAGATCTCCAAAAAGAAAGGACTCGTC

Reverse complement sequence

GACGAGTCCTTTCTTTTTGGAGATCTTTTTAACCGGACCTCCCTTCGCCGCCTGTTCACAGAAAACACGAGGCCTGGGAGATCTGCTTAACTCTAGTACA[G/T]
GTCCAAAGCTCGCATTCGAATGTATGATTCGGATTCAGCCGATTCTGGTCATAGCCGATTTGGACTCCAGCTGATTCTTACTCTATTCCCGCAGCATTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 12.40% 0.30% 6.92% NA
All Indica  2759 74.00% 14.50% 0.43% 11.09% NA
All Japonica  1512 96.40% 2.70% 0.00% 0.86% NA
Aus  269 60.60% 37.50% 0.74% 1.12% NA
Indica I  595 78.50% 18.30% 0.34% 2.86% NA
Indica II  465 82.20% 5.20% 0.86% 11.83% NA
Indica III  913 66.60% 15.60% 0.55% 17.31% NA
Indica Intermediate  786 74.40% 15.80% 0.13% 9.67% NA
Temperate Japonica  767 96.00% 3.90% 0.00% 0.13% NA
Tropical Japonica  504 97.40% 0.40% 0.00% 2.18% NA
Japonica Intermediate  241 95.90% 3.70% 0.00% 0.41% NA
VI/Aromatic  96 61.50% 36.50% 0.00% 2.08% NA
Intermediate  90 83.30% 13.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406165696 C -> DEL N N silent_mutation Average:20.261; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0406165696 C -> A LOC_Os04g11280.1 upstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:20.261; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0406165696 C -> A LOC_Os04g11300.1 downstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:20.261; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0406165696 C -> A LOC_Os04g11290.1 intron_variant ; MODIFIER silent_mutation Average:20.261; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406165696 3.00E-09 1.25E-13 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 2.35E-06 3.15E-10 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.96E-08 2.20E-13 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 3.64E-10 4.87E-15 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 9.86E-09 3.40E-13 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 5.15E-09 2.19E-13 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 4.16E-12 5.43E-19 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 2.24E-09 1.77E-13 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.61E-06 6.51E-10 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 4.54E-07 6.66E-16 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 4.66E-06 2.23E-08 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 6.47E-12 1.48E-16 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.89E-09 1.78E-13 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 3.82E-11 7.03E-18 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 4.72E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.76E-12 3.77E-17 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.29E-06 3.04E-10 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 NA 5.07E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 NA 9.64E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.04E-16 7.09E-27 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 4.12E-10 1.20E-13 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 NA 1.46E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.22E-06 4.03E-11 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 1.58E-18 9.45E-29 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406165696 2.44E-09 2.00E-17 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251