\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406145439:

Variant ID: vg0406145439 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6145439
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACAAAATTTTAAGTTTTATGGCTGAAGAAGATATCCATAAAACAACTTTTAGATGTCCTGGTGCAATCGGCTTATTTGAGTGGGTTGTTATGACTTT[C/T]
GGCTTGAAGAGTGCTAGAGCTACATATAAAAGGGCCATGAATTATATTTATCATGATCTGATTGGCTGGCTGGTTGAGGTCTATATTGATGATGTGGTTG

Reverse complement sequence

CAACCACATCATCAATATAGACCTCAACCAGCCAGCCAATCAGATCATGATAAATATAATTCATGGCCCTTTTATATGTAGCTCTAGCACTCTTCAAGCC[G/A]
AAAGTCATAACAACCCACTCAAATAAGCCGATTGCACCAGGACATCTAAAAGTTGTTTTATGGATATCTTCTTCAGCCATAAAACTTAAAATTTTGTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 12.30% 1.27% 5.23% NA
All Indica  2759 75.90% 14.20% 2.03% 7.87% NA
All Japonica  1512 95.60% 2.70% 0.07% 1.59% NA
Aus  269 61.70% 37.50% 0.00% 0.74% NA
Indica I  595 77.10% 17.80% 1.01% 4.03% NA
Indica II  465 84.70% 4.90% 3.44% 6.88% NA
Indica III  913 75.70% 15.30% 1.75% 7.23% NA
Indica Intermediate  786 70.00% 15.60% 2.29% 12.09% NA
Temperate Japonica  767 96.00% 3.90% 0.00% 0.13% NA
Tropical Japonica  504 95.20% 0.40% 0.20% 4.17% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 61.50% 36.50% 0.00% 2.08% NA
Intermediate  90 82.20% 12.20% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406145439 C -> DEL LOC_Os04g11240.1 N frameshift_variant Average:17.009; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0406145439 C -> T LOC_Os04g11240.1 synonymous_variant ; p.Phe1048Phe; LOW synonymous_codon Average:17.009; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406145439 2.15E-09 1.13E-14 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 6.89E-07 1.28E-11 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 2.72E-08 3.00E-14 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 3.59E-10 3.03E-16 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 3.15E-09 7.43E-15 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.09E-09 9.04E-15 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 2.83E-12 4.64E-21 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 7.88E-10 7.99E-15 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 2.02E-07 2.67E-11 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.72E-06 1.72E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.97E-16 8.45E-28 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 9.71E-06 NA mr1946 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 NA 2.47E-08 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 7.20E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.62E-12 2.29E-18 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.09E-10 7.58E-16 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 2.56E-13 1.66E-21 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 7.19E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.08E-12 6.04E-19 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.17E-08 4.36E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.03E-16 2.96E-30 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.82E-12 1.60E-16 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 NA 5.26E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 9.23E-11 3.45E-16 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 8.49E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 5.11E-21 3.49E-34 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439 1.34E-09 3.97E-19 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251