Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406145439:

Variant ID: vg0406145439 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6145439
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

GGAACAAAATTTTAAGTTTTATGGCTGAAGAAGATATCCATAAAACAACTTTTAGATGTCCTGGTGCAATCGGCTTATTTGAGTGGGTTGTTATGACTTT[C/T]
GGCTTGAAGAGTGCTAGAGCTACATATAAAAGGGCCATGAATTATATTTATCATGATCTGATTGGCTGGCTGGTTGAGGTCTATATTGATGATGTGGTTG

Reverse complement sequence

CAACCACATCATCAATATAGACCTCAACCAGCCAGCCAATCAGATCATGATAAATATAATTCATGGCCCTTTTATATGTAGCTCTAGCACTCTTCAAGCC[G/A]
AAAGTCATAACAACCCACTCAAATAAGCCGATTGCACCAGGACATCTAAAAGTTGTTTTATGGATATCTTCTTCAGCCATAAAACTTAAAATTTTGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	12.30%	1.27%	5.23%	NA
All Indica	2759	75.90%	14.20%	2.03%	7.87%	NA
All Japonica	1512	95.60%	2.70%	0.07%	1.59%	NA
Aus	269	61.70%	37.50%	0.00%	0.74%	NA
Indica I	595	77.10%	17.80%	1.01%	4.03%	NA
Indica II	465	84.70%	4.90%	3.44%	6.88%	NA
Indica III	913	75.70%	15.30%	1.75%	7.23%	NA
Indica Intermediate	786	70.00%	15.60%	2.29%	12.09%	NA
Temperate Japonica	767	96.00%	3.90%	0.00%	0.13%	NA
Tropical Japonica	504	95.20%	0.40%	0.20%	4.17%	NA
Japonica Intermediate	241	95.40%	3.70%	0.00%	0.83%	NA
VI/Aromatic	96	61.50%	36.50%	0.00%	2.08%	NA
Intermediate	90	82.20%	12.20%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406145439	C -> DEL	LOC_Os04g11240.1	N	frameshift_variant	Average:17.009; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0406145439	C -> T	LOC_Os04g11240.1	synonymous_variant ; p.Phe1048Phe; LOW	synonymous_codon	Average:17.009; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406145439	2.15E-09	1.13E-14	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	6.89E-07	1.28E-11	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	2.72E-08	3.00E-14	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	3.59E-10	3.03E-16	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	3.15E-09	7.43E-15	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.09E-09	9.04E-15	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	2.83E-12	4.64E-21	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	7.88E-10	7.99E-15	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	2.02E-07	2.67E-11	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.72E-06	1.72E-06	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.97E-16	8.45E-28	mr1913	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	9.71E-06	NA	mr1946	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	NA	2.47E-08	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	7.20E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.62E-12	2.29E-18	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.09E-10	7.58E-16	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	2.56E-13	1.66E-21	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	7.19E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.08E-12	6.04E-19	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.17E-08	4.36E-13	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.03E-16	2.96E-30	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.82E-12	1.60E-16	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	NA	5.26E-08	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	9.23E-11	3.45E-16	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	8.49E-06	NA	mr1888_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	5.11E-21	3.49E-34	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406145439	1.34E-09	3.97E-19	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251