\
| Variant ID: vg0406060650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6060650 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 112. )
ACCAGGTTACAAACCACCAAGGGATGTAATGTGCCCGGTATTAATAGCTGGAGTGTGTTAAATACCCGGCTTTAAAGTTTGAGGGTGTATTTTATACAAA[A/G]
TGAATAATTAAGGGGGTTAAAATAGACTTATCCCTTTTTTTTAAGTCATAAGGATTTTTATCCAATTATTTTTCTTCTTTACATGTATTGTCCAATTCTT
AAGAATTGGACAATACATGTAAAGAAGAAAAATAATTGGATAAAAATCCTTATGACTTAAAAAAAAGGGATAAGTCTATTTTAACCCCCTTAATTATTCA[T/C]
TTTGTATAAAATACACCCTCAAACTTTAAAGCCGGGTATTTAACACACTCCAGCTATTAATACCGGGCACATTACATCCCTTGGTGGTTTGTAACCTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 22.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 78.90% | 21.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 79.80% | 20.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 62.80% | 37.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.00% | 25.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 51.80% | 48.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406060650 | A -> G | LOC_Os04g11140.1 | upstream_gene_variant ; 744.0bp to feature; MODIFIER | silent_mutation | Average:41.022; most accessible tissue: Callus, score: 64.184 | N | N | N | N |
| vg0406060650 | A -> G | LOC_Os04g11150.1 | upstream_gene_variant ; 1447.0bp to feature; MODIFIER | silent_mutation | Average:41.022; most accessible tissue: Callus, score: 64.184 | N | N | N | N |
| vg0406060650 | A -> G | LOC_Os04g11140-LOC_Os04g11150 | intergenic_region ; MODIFIER | silent_mutation | Average:41.022; most accessible tissue: Callus, score: 64.184 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406060650 | NA | 5.47E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | NA | 8.77E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | NA | 1.13E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | NA | 4.89E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 4.86E-07 | 4.07E-08 | mr1071_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 1.34E-06 | 1.89E-08 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 4.34E-06 | 8.90E-10 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 8.04E-07 | 3.20E-08 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | NA | 2.99E-07 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 1.81E-07 | 6.35E-10 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | NA | 5.76E-07 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 1.93E-06 | 1.39E-09 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406060650 | 1.06E-06 | 2.21E-10 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |