Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406057280:

Variant ID: vg0406057280 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6057280
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, G: 0.11, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAGATAAGTCCAACACAACTGCACATCAACTGGTCTATCGAAATATGCATGACAATGAAATTTGATATTAGCTGATAATGTAGTTCAGCTTTGGTATA[C/G]
ATCGATTGAAGGATCATTGTCTGCTTGCAAAGACCAAAGATCGAATTTCTGCAGTTATTGGGGCTTACTGAACAACCAATCTTAGTAAGCTAAGCTGGCC

Reverse complement sequence

GGCCAGCTTAGCTTACTAAGATTGGTTGTTCAGTAAGCCCCAATAACTGCAGAAATTCGATCTTTGGTCTTTGCAAGCAGACAATGATCCTTCAATCGAT[G/C]
TATACCAAAGCTGAACTACATTATCAGCTAATATCAAATTTCATTGTCATGCATATTTCGATAGACCAGTTGATGTGCAGTTGTGTTGGACTTATCTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.90%	21.00%	0.11%	0.00%	NA
All Indica	2759	80.90%	18.90%	0.14%	0.00%	NA
All Japonica	1512	79.70%	20.20%	0.07%	0.00%	NA
Aus	269	62.80%	37.20%	0.00%	0.00%	NA
Indica I	595	79.20%	20.80%	0.00%	0.00%	NA
Indica II	465	86.70%	13.10%	0.22%	0.00%	NA
Indica III	913	83.70%	16.30%	0.00%	0.00%	NA
Indica Intermediate	786	75.70%	23.90%	0.38%	0.00%	NA
Temperate Japonica	767	95.20%	4.80%	0.00%	0.00%	NA
Tropical Japonica	504	51.60%	48.40%	0.00%	0.00%	NA
Japonica Intermediate	241	89.20%	10.40%	0.41%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406057280	C -> G	LOC_Os04g11130.1	upstream_gene_variant ; 2427.0bp to feature; MODIFIER	silent_mutation	Average:37.095; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0406057280	C -> G	LOC_Os04g11150.1	upstream_gene_variant ; 4817.0bp to feature; MODIFIER	silent_mutation	Average:37.095; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0406057280	C -> G	LOC_Os04g11120.1	downstream_gene_variant ; 3887.0bp to feature; MODIFIER	silent_mutation	Average:37.095; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0406057280	C -> G	LOC_Os04g11140.1	downstream_gene_variant ; 2238.0bp to feature; MODIFIER	silent_mutation	Average:37.095; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0406057280	C -> G	LOC_Os04g11130-LOC_Os04g11140	intergenic_region ; MODIFIER	silent_mutation	Average:37.095; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406057280	7.66E-06	NA	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	NA	1.34E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	4.64E-07	2.54E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	3.07E-06	9.74E-07	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	NA	8.61E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	1.18E-08	9.19E-09	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	1.56E-08	2.85E-09	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	8.71E-09	3.13E-11	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	5.14E-09	4.07E-09	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	1.02E-07	1.79E-08	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	4.92E-10	7.66E-11	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	1.83E-07	3.77E-08	mr1619_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	NA	2.65E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	6.51E-07	NA	mr1888_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	NA	3.05E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	2.79E-08	2.65E-10	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406057280	2.42E-08	4.44E-11	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251