Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406056794:

Variant ID: vg0406056794 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6056794
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.19, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAATAACCTCGGAGTAATCCATTTACTGAGGGAAGGAATCAATTTGGGAGCATTGGAGTGTTAGTAACTCATTTTCTGAGTGGCTGATAAACTTAGTA[A/G]
TCTTGTTACTGATGGGATAATCACGAAAAAAAGTGCGAGAGGAAATAAAAAAAAAGAGGAAAGAAAAAAAGGTGCGGCCTAGTTCTGCAGGATTGATGGT

Reverse complement sequence

ACCATCAATCCTGCAGAACTAGGCCGCACCTTTTTTTCTTTCCTCTTTTTTTTTATTTCCTCTCGCACTTTTTTTCGTGATTATCCCATCAGTAACAAGA[T/C]
TACTAAGTTTATCAGCCACTCAGAAAATGAGTTACTAACACTCCAATGCTCCCAAATTGATTCCTTCCCTCAGTAAATGGATTACTCCGAGGTTATTTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	1.10%	30.19%	6.14%	NA
All Indica	2759	53.10%	1.60%	37.30%	7.94%	NA
All Japonica	1512	79.70%	0.40%	18.78%	1.12%	NA
Aus	269	63.20%	0.70%	23.42%	12.64%	NA
Indica I	595	73.90%	0.20%	17.48%	8.40%	NA
Indica II	465	72.30%	0.20%	23.01%	4.52%	NA
Indica III	913	31.50%	3.10%	57.61%	7.78%	NA
Indica Intermediate	786	51.10%	1.90%	37.15%	9.80%	NA
Temperate Japonica	767	95.40%	0.00%	3.26%	1.30%	NA
Tropical Japonica	504	51.00%	1.20%	47.62%	0.20%	NA
Japonica Intermediate	241	89.60%	0.00%	7.88%	2.49%	NA
VI/Aromatic	96	56.20%	0.00%	26.04%	17.71%	NA
Intermediate	90	67.80%	0.00%	28.89%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406056794	A -> DEL	N	N	silent_mutation	Average:25.614; most accessible tissue: Callus, score: 41.098	N	N	N	N
vg0406056794	A -> G	LOC_Os04g11130.1	upstream_gene_variant ; 1941.0bp to feature; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Callus, score: 41.098	N	N	N	N
vg0406056794	A -> G	LOC_Os04g11120.1	downstream_gene_variant ; 3401.0bp to feature; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Callus, score: 41.098	N	N	N	N
vg0406056794	A -> G	LOC_Os04g11140.1	downstream_gene_variant ; 2724.0bp to feature; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Callus, score: 41.098	N	N	N	N
vg0406056794	A -> G	LOC_Os04g11130-LOC_Os04g11140	intergenic_region ; MODIFIER	silent_mutation	Average:25.614; most accessible tissue: Callus, score: 41.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406056794	NA	6.99E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	6.94E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	5.87E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	7.77E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	1.07E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.43E-07	1.22E-07	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.08E-07	2.82E-08	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.21E-07	5.00E-10	mr1100_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	7.68E-08	8.00E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.91E-06	2.55E-07	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.44E-08	2.01E-09	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	4.36E-07	1.24E-07	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	4.60E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	1.13E-06	NA	mr1888_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	NA	2.06E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	4.47E-09	9.38E-11	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056794	2.21E-07	5.35E-10	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251