\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406040035:

Variant ID: vg0406040035 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6040035
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGCCACATCCCTAAGAAATAAGGGACTGTCCGTTAATTACTACTTATACGGATGTTCTAGGCGGTCGGATCCTTGATTGGCAAAATATGTTCACGAT[A/C]
TTTCAAGAAAGCACGGATGTTCCCTGCAGTAGAAAATTAGTAGCATTTTCCCCTTCCTCCAAGGTTGCAGACTGGGACCCCTCCTTCATCCTATTCTCGA

Reverse complement sequence

TCGAGAATAGGATGAAGGAGGGGTCCCAGTCTGCAACCTTGGAGGAAGGGGAAAATGCTACTAATTTTCTACTGCAGGGAACATCCGTGCTTTCTTGAAA[T/G]
ATCGTGAACATATTTTGCCAATCAAGGATCCGACCGCCTAGAACATCCGTATAAGTAGTAATTAACGGACAGTCCCTTATTTCTTAGGGATGTGGCTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.00% 0.02% 0.00% NA
All Indica  2759 66.50% 33.50% 0.04% 0.00% NA
All Japonica  1512 38.10% 61.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 28.40% 71.60% 0.00% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 70.40% 29.50% 0.13% 0.00% NA
Temperate Japonica  767 29.30% 70.70% 0.00% 0.00% NA
Tropical Japonica  504 57.50% 42.50% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 74.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406040035 A -> C LOC_Os04g11090.1 upstream_gene_variant ; 1664.0bp to feature; MODIFIER silent_mutation Average:72.394; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0406040035 A -> C LOC_Os04g11100.1 upstream_gene_variant ; 1418.0bp to feature; MODIFIER silent_mutation Average:72.394; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0406040035 A -> C LOC_Os04g11090-LOC_Os04g11100 intergenic_region ; MODIFIER silent_mutation Average:72.394; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406040035 A C -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406040035 6.08E-06 4.08E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 6.18E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 2.08E-06 2.07E-06 mr1258 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 7.58E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 5.10E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 1.68E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 7.78E-07 7.78E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 8.39E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 6.40E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 1.95E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 1.19E-08 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 4.50E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 9.47E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 3.41E-06 1.62E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 5.86E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 4.44E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 4.39E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 2.47E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 4.50E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 3.29E-13 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406040035 NA 8.98E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251