\
| Variant ID: vg0406038870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6038870 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )
AGTGGTTTCGCTCGGAGTCCCCACGGTCGGCGCCAGCTGTTGTCGAAACGACAACTGCATACGTCGGAGGACGTGGTTACTCAACAGTGGTTGGGAAAAT[G/A]
AAGTGTACTAAATTTTTAATTTTTCTTGGATCCCCCCATTACATGGCCCTAGGGGACTATTTATAGCCCCATTACAGGTCCTTACTACCAGCGTTTAGGT
ACCTAAACGCTGGTAGTAAGGACCTGTAATGGGGCTATAAATAGTCCCCTAGGGCCATGTAATGGGGGGATCCAAGAAAAATTAAAAATTTAGTACACTT[C/T]
ATTTTCCCAACCACTGTTGAGTAACCACGTCCTCCGACGTATGCAGTTGTCGTTTCGACAACAGCTGGCGCCGACCGTGGGGACTCCGAGCGAAACCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 7.60% | 5.27% | 8.93% | NA |
| All Indica | 2759 | 66.60% | 11.00% | 8.77% | 13.66% | NA |
| All Japonica | 1512 | 96.90% | 0.50% | 0.33% | 2.25% | NA |
| Aus | 269 | 97.40% | 0.40% | 0.37% | 1.86% | NA |
| Indica I | 595 | 72.40% | 5.40% | 10.76% | 11.43% | NA |
| Indica II | 465 | 63.20% | 6.00% | 16.13% | 14.62% | NA |
| Indica III | 913 | 64.00% | 16.40% | 6.02% | 13.58% | NA |
| Indica Intermediate | 786 | 67.20% | 11.80% | 6.11% | 14.89% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 95.00% | 0.80% | 0.60% | 3.57% | NA |
| Japonica Intermediate | 241 | 92.50% | 1.20% | 0.41% | 5.81% | NA |
| VI/Aromatic | 96 | 58.30% | 40.60% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 82.20% | 11.10% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406038870 | G -> DEL | N | N | silent_mutation | Average:46.482; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0406038870 | G -> A | LOC_Os04g11090.1 | upstream_gene_variant ; 499.0bp to feature; MODIFIER | silent_mutation | Average:46.482; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0406038870 | G -> A | LOC_Os04g11100.1 | upstream_gene_variant ; 2583.0bp to feature; MODIFIER | silent_mutation | Average:46.482; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0406038870 | G -> A | LOC_Os04g11090-LOC_Os04g11100 | intergenic_region ; MODIFIER | silent_mutation | Average:46.482; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406038870 | NA | 5.41E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 2.67E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 2.27E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | 7.78E-07 | 7.58E-08 | mr1210 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 3.04E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 6.14E-09 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | 1.66E-07 | 9.78E-10 | mr1305 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 6.61E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 3.18E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 3.95E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 4.31E-06 | mr1552 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | 3.03E-06 | 1.67E-09 | mr1586 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 8.98E-07 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | 2.11E-06 | 1.76E-06 | mr1765 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 4.72E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406038870 | NA | 4.54E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |