Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406038483:

Variant ID: vg0406038483 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6038483
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCTTCCATGTCGGCTTCGGCTTGCGCTTTGGGGTCCAGGCTGATTTGGGCCAGTACAACGGCGAGCGCAGTTGGCGCCGCCGGCTGCGATGTGGCGGC[T/C]
TGAGGCACCACCAGTTGGTTTGTCGAAAGGATCTCCGCCCTGGTCTGGAGTGCCCTTGTCGCCACGTCTGCCGTGTTCGGCACTTGCACTGAGGTTGCTG

Reverse complement sequence

CAGCAACCTCAGTGCAAGTGCCGAACACGGCAGACGTGGCGACAAGGGCACTCCAGACCAGGGCGGAGATCCTTTCGACAAACCAACTGGTGGTGCCTCA[A/G]
GCCGCCACATCGCAGCCGGCGGCGCCAACTGCGCTCGCCGTTGTACTGGCCCAAATCAGCCTGGACCCCAAAGCGCAAGCCGAAGCCGACATGGAAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	21.50%	3.00%	0.91%	NA
All Indica	2759	80.40%	14.90%	3.30%	1.41%	NA
All Japonica	1512	69.00%	28.80%	2.18%	0.00%	NA
Aus	269	55.00%	37.90%	5.58%	1.49%	NA
Indica I	595	80.30%	15.10%	1.85%	2.69%	NA
Indica II	465	86.70%	9.70%	3.01%	0.65%	NA
Indica III	913	82.40%	12.80%	3.61%	1.20%	NA
Indica Intermediate	786	74.30%	20.40%	4.20%	1.15%	NA
Temperate Japonica	767	75.70%	23.60%	0.65%	0.00%	NA
Tropical Japonica	504	52.40%	43.10%	4.56%	0.00%	NA
Japonica Intermediate	241	82.20%	15.80%	2.07%	0.00%	NA
VI/Aromatic	96	50.00%	49.00%	1.04%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406038483	T -> C	LOC_Os04g11090.1	upstream_gene_variant ; 112.0bp to feature; MODIFIER	silent_mutation	Average:28.478; most accessible tissue: Callus, score: 39.714	N	N	N	N
vg0406038483	T -> C	LOC_Os04g11100.1	upstream_gene_variant ; 2970.0bp to feature; MODIFIER	silent_mutation	Average:28.478; most accessible tissue: Callus, score: 39.714	N	N	N	N
vg0406038483	T -> C	LOC_Os04g11090-LOC_Os04g11100	intergenic_region ; MODIFIER	silent_mutation	Average:28.478; most accessible tissue: Callus, score: 39.714	N	N	N	N
vg0406038483	T -> DEL	N	N	silent_mutation	Average:28.478; most accessible tissue: Callus, score: 39.714	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406038483	NA	3.33E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	2.99E-06	4.48E-08	mr1312	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	8.68E-06	8.68E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	NA	5.12E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	NA	8.26E-06	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	3.38E-06	8.47E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038483	NA	9.10E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251