\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406038377:

Variant ID: vg0406038377 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6038377
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATTGGAGCCGACGTGGCCTTGGTCCGCCTTGTCGCCTCGTATGCTTGTTGTTGTTCTTGCATTTGGCGAAGCATGTCTTGGAGCCATGTCATGTTCT[A/G]
CCGCATGGCTTCCATGTCGGCTTCGGCTTGCGCTTTGGGGTCCAGGCTGATTTGGGCCAGTACAACGGCGAGCGCAGTTGGCGCCGCCGGCTGCGATGTG

Reverse complement sequence

CACATCGCAGCCGGCGGCGCCAACTGCGCTCGCCGTTGTACTGGCCCAAATCAGCCTGGACCCCAAAGCGCAAGCCGAAGCCGACATGGAAGCCATGCGG[T/C]
AGAACATGACATGGCTCCAAGACATGCTTCGCCAAATGCAAGAACAACAACAAGCATACGAGGCGACAAGGCGGACCAAGGCCACGTCGGCTCCAATCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 39.90% 11.68% 1.54% NA
All Indica  2759 52.40% 34.40% 11.74% 1.52% NA
All Japonica  1512 26.70% 59.70% 11.71% 1.98% NA
Aus  269 89.20% 1.50% 9.29% 0.00% NA
Indica I  595 23.90% 72.10% 3.87% 0.17% NA
Indica II  465 54.40% 18.10% 21.51% 6.02% NA
Indica III  913 65.90% 20.80% 13.03% 0.22% NA
Indica Intermediate  786 57.00% 31.20% 10.43% 1.40% NA
Temperate Japonica  767 26.10% 65.70% 8.21% 0.00% NA
Tropical Japonica  504 34.70% 43.10% 17.66% 4.56% NA
Japonica Intermediate  241 11.60% 75.10% 10.37% 2.90% NA
VI/Aromatic  96 76.00% 4.20% 19.79% 0.00% NA
Intermediate  90 58.90% 32.20% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406038377 A -> DEL N N silent_mutation Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0406038377 A -> G LOC_Os04g11090.1 upstream_gene_variant ; 6.0bp to feature; MODIFIER silent_mutation Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0406038377 A -> G LOC_Os04g11100.1 upstream_gene_variant ; 3076.0bp to feature; MODIFIER silent_mutation Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0406038377 A -> G LOC_Os04g11090-LOC_Os04g11100 intergenic_region ; MODIFIER silent_mutation Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406038377 8.65E-07 3.33E-09 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 3.91E-06 1.39E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 6.31E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 8.74E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 3.45E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 8.02E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 7.76E-07 1.27E-10 mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 1.30E-07 1.30E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 4.03E-08 2.13E-11 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 4.00E-07 4.00E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.54E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.59E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.54E-10 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 3.98E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 9.96E-07 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 1.92E-08 7.77E-12 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 4.70E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 1.38E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.98E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 5.56E-07 5.56E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 5.52E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 6.00E-07 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 3.42E-07 6.42E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 9.81E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.45E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 2.38E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 3.53E-15 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377 NA 9.25E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251