Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406038377:

Variant ID: vg0406038377 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6038377
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AGGATTGGAGCCGACGTGGCCTTGGTCCGCCTTGTCGCCTCGTATGCTTGTTGTTGTTCTTGCATTTGGCGAAGCATGTCTTGGAGCCATGTCATGTTCT[A/G]
CCGCATGGCTTCCATGTCGGCTTCGGCTTGCGCTTTGGGGTCCAGGCTGATTTGGGCCAGTACAACGGCGAGCGCAGTTGGCGCCGCCGGCTGCGATGTG

Reverse complement sequence

CACATCGCAGCCGGCGGCGCCAACTGCGCTCGCCGTTGTACTGGCCCAAATCAGCCTGGACCCCAAAGCGCAAGCCGAAGCCGACATGGAAGCCATGCGG[T/C]
AGAACATGACATGGCTCCAAGACATGCTTCGCCAAATGCAAGAACAACAACAAGCATACGAGGCGACAAGGCGGACCAAGGCCACGTCGGCTCCAATCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	39.90%	11.68%	1.54%	NA
All Indica	2759	52.40%	34.40%	11.74%	1.52%	NA
All Japonica	1512	26.70%	59.70%	11.71%	1.98%	NA
Aus	269	89.20%	1.50%	9.29%	0.00%	NA
Indica I	595	23.90%	72.10%	3.87%	0.17%	NA
Indica II	465	54.40%	18.10%	21.51%	6.02%	NA
Indica III	913	65.90%	20.80%	13.03%	0.22%	NA
Indica Intermediate	786	57.00%	31.20%	10.43%	1.40%	NA
Temperate Japonica	767	26.10%	65.70%	8.21%	0.00%	NA
Tropical Japonica	504	34.70%	43.10%	17.66%	4.56%	NA
Japonica Intermediate	241	11.60%	75.10%	10.37%	2.90%	NA
VI/Aromatic	96	76.00%	4.20%	19.79%	0.00%	NA
Intermediate	90	58.90%	32.20%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406038377	A -> DEL	N	N	silent_mutation	Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0406038377	A -> G	LOC_Os04g11090.1	upstream_gene_variant ; 6.0bp to feature; MODIFIER	silent_mutation	Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0406038377	A -> G	LOC_Os04g11100.1	upstream_gene_variant ; 3076.0bp to feature; MODIFIER	silent_mutation	Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0406038377	A -> G	LOC_Os04g11090-LOC_Os04g11100	intergenic_region ; MODIFIER	silent_mutation	Average:33.453; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406038377	8.65E-07	3.33E-09	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	3.91E-06	1.39E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	6.31E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	8.74E-06	mr1143	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	3.45E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	8.02E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	7.76E-07	1.27E-10	mr1525	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	1.30E-07	1.30E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	4.03E-08	2.13E-11	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	4.00E-07	4.00E-07	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.54E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.59E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.54E-10	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	3.98E-06	mr1995	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	9.96E-07	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	1.92E-08	7.77E-12	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	4.70E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	1.38E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.98E-06	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	5.56E-07	5.56E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	5.52E-10	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	6.00E-07	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	3.42E-07	6.42E-11	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	9.81E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.45E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	2.38E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	3.53E-15	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406038377	NA	9.25E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251