\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406037789:

Variant ID: vg0406037789 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6037789
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTCCCCCACTCAGCGGTAGCCCCTTTTCGCCTCCCGCCCTCTTTACCGCACCTTGCTGCGGGTACGGTGTGGCGAAGGGTGAAATCGCAGCTTGTG[C/T]
GTGAAGTTGGGCCATGGCGTTCGGCTGCCCGGCTCCAACTGGAGGCACTTGCTGAGCCGCCATGGATGGGTCAAAAATTGGCTGCGACCACGTCATGGCA

Reverse complement sequence

TGCCATGACGTGGTCGCAGCCAATTTTTGACCCATCCATGGCGGCTCAGCAAGTGCCTCCAGTTGGAGCCGGGCAGCCGAACGCCATGGCCCAACTTCAC[G/A]
CACAAGCTGCGATTTCACCCTTCGCCACACCGTACCCGCAGCAAGGTGCGGTAAAGAGGGCGGGAGGCGAAAAGGGGCTACCGCTGAGTGGGGGAATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 5.20% 0.06% 0.44% NA
All Indica  2759 91.20% 8.70% 0.11% 0.00% NA
All Japonica  1512 98.40% 0.20% 0.00% 1.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 87.10% 12.80% 0.11% 0.00% NA
Indica Intermediate  786 89.20% 10.60% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 0.60% 0.00% 3.17% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406037789 C -> DEL LOC_Os04g11090.1 N frameshift_variant Average:45.517; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0406037789 C -> T LOC_Os04g11090.1 missense_variant ; p.Ala195Thr; MODERATE nonsynonymous_codon ; A195T Average:45.517; most accessible tissue: Minghui63 young leaf, score: 73.49 benign 0.382 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406037789 NA 6.20E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 5.96E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 1.12E-07 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 3.72E-10 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 5.88E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 6.38E-06 4.00E-10 mr1305 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 2.21E-07 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 6.09E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 2.45E-09 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 9.88E-08 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 3.24E-07 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 8.95E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406037789 NA 5.17E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251