\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406033822:

Variant ID: vg0406033822 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6033822
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCAATGGGCTGCAGATCATACTAGGGCGTGGCTTGGCTTCGGCCATGACGCTAGCAATTTTCGCACTTCTTGATTTGCTCAACACAGACTTTCAACACA[G/A]
TGGGCCAATAAACTCCTTGTCTAAATACTTTGGAAGCCACTGTTCTTGCAGCCTGGTGTGCGCCACATAGCCCCTGGTGTATCTCCTTTGCCATTTGTTC

Reverse complement sequence

GAACAAATGGCAAAGGAGATACACCAGGGGCTATGTGGCGCACACCAGGCTGCAAGAACAGTGGCTTCCAAAGTATTTAGACAAGGAGTTTATTGGCCCA[C/T]
TGTGTTGAAAGTCTGTGTTGAGCAAATCAAGAAGTGCGAAAATTGCTAGCGTCATGGCCGAAGCCAAGCCACGCCCTAGTATGATCTGCAGCCCATTGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 4.60% 0.80% 0.97% NA
All Indica  2759 89.90% 7.60% 1.38% 1.09% NA
All Japonica  1512 98.70% 0.20% 0.00% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.00% 4.50% 0.50% 0.00% NA
Indica II  465 97.20% 2.40% 0.22% 0.22% NA
Indica III  913 84.60% 10.50% 2.63% 2.30% NA
Indica Intermediate  786 88.00% 9.70% 1.27% 1.02% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 0.60% 0.00% 2.58% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406033822 G -> DEL N N silent_mutation Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0406033822 G -> A LOC_Os04g11080.1 downstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0406033822 G -> A LOC_Os04g11090.1 intron_variant ; MODIFIER silent_mutation Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406033822 NA 4.53E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 NA 5.66E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 NA 2.60E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 NA 6.09E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 NA 4.67E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 4.96E-06 2.67E-06 mr1515 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 7.54E-06 1.37E-06 mr1552 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406033822 NA 3.67E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251