\
| Variant ID: vg0406033822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6033822 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCAATGGGCTGCAGATCATACTAGGGCGTGGCTTGGCTTCGGCCATGACGCTAGCAATTTTCGCACTTCTTGATTTGCTCAACACAGACTTTCAACACA[G/A]
TGGGCCAATAAACTCCTTGTCTAAATACTTTGGAAGCCACTGTTCTTGCAGCCTGGTGTGCGCCACATAGCCCCTGGTGTATCTCCTTTGCCATTTGTTC
GAACAAATGGCAAAGGAGATACACCAGGGGCTATGTGGCGCACACCAGGCTGCAAGAACAGTGGCTTCCAAAGTATTTAGACAAGGAGTTTATTGGCCCA[C/T]
TGTGTTGAAAGTCTGTGTTGAGCAAATCAAGAAGTGCGAAAATTGCTAGCGTCATGGCCGAAGCCAAGCCACGCCCTAGTATGATCTGCAGCCCATTGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 4.60% | 0.80% | 0.97% | NA |
| All Indica | 2759 | 89.90% | 7.60% | 1.38% | 1.09% | NA |
| All Japonica | 1512 | 98.70% | 0.20% | 0.00% | 1.06% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 4.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.22% | 0.22% | NA |
| Indica III | 913 | 84.60% | 10.50% | 2.63% | 2.30% | NA |
| Indica Intermediate | 786 | 88.00% | 9.70% | 1.27% | 1.02% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 0.60% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406033822 | G -> DEL | N | N | silent_mutation | Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0406033822 | G -> A | LOC_Os04g11080.1 | downstream_gene_variant ; 2414.0bp to feature; MODIFIER | silent_mutation | Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0406033822 | G -> A | LOC_Os04g11090.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.704; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406033822 | NA | 4.53E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | NA | 5.66E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | NA | 2.60E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | NA | 6.09E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | NA | 4.67E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | 4.96E-06 | 2.67E-06 | mr1515 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | 7.54E-06 | 1.37E-06 | mr1552 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406033822 | NA | 3.67E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |